Incidental Mutation 'R4460:Vmn2r121'
ID330125
Institutional Source Beutler Lab
Gene Symbol Vmn2r121
Ensembl Gene ENSMUSG00000072049
Gene Namevomeronasal 2, receptor 121
SynonymsEG625699
MMRRC Submission 041719-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4460 (G1)
Quality Score84
Status Not validated
ChromosomeX
Chromosomal Location124127339-124135910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 124128584 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 580 (P580S)
Ref Sequence ENSEMBL: ENSMUSP00000092067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094491]
Predicted Effect probably benign
Transcript: ENSMUST00000094491
AA Change: P580S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000092067
Gene: ENSMUSG00000072049
AA Change: P580S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 75 448 3.2e-26 PFAM
Pfam:NCD3G 506 560 2.1e-19 PFAM
Pfam:7tm_3 593 828 3.8e-56 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,152,856 T1268I probably benign Het
A830010M20Rik A G 5: 107,503,765 T687A possibly damaging Het
C030048H21Rik A G 2: 26,255,863 probably null Het
Cav1 A G 6: 17,306,472 D8G probably damaging Het
Celf6 G A 9: 59,603,044 R103H probably damaging Het
Ctr9 A G 7: 111,046,894 I698V probably benign Het
Cts6 G C 13: 61,195,458 I316M probably benign Het
Dnajc13 C A 9: 104,181,063 R1496L probably damaging Het
Dscam A G 16: 96,610,319 Y1786H probably damaging Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Ltk A G 2: 119,755,613 probably null Het
Med20 T C 17: 47,618,917 V93A probably benign Het
Mmp9 G T 2: 164,949,038 K115N probably damaging Het
Mroh5 A T 15: 73,791,796 D339E probably damaging Het
Muc1 A T 3: 89,231,563 D493V probably damaging Het
Mx1 G T 16: 97,454,081 S113R probably damaging Het
Nlrp9c T A 7: 26,378,098 H698L probably damaging Het
Nol9 T G 4: 152,057,836 L641R probably damaging Het
Park2 A T 17: 12,061,646 D463V probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Ptcd1 G T 5: 145,159,506 A259E probably benign Het
Ptov1 T C 7: 44,865,576 M204V probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rbbp8nl A G 2: 180,280,971 S210P probably benign Het
Rgmb C A 17: 15,807,626 R277L probably benign Het
Snx2 A G 18: 53,176,444 E22G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tmem143 C T 7: 45,906,952 T97I probably damaging Het
Ttn A C 2: 76,814,647 F12955V probably damaging Het
Ubr2 C T 17: 46,945,045 probably null Het
Vmn1r203 T A 13: 22,524,682 M211K probably damaging Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Vmn2r121
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r121 APN X 124127802 missense probably benign 0.04
IGL00990:Vmn2r121 APN X 124127783 missense possibly damaging 0.95
IGL00990:Vmn2r121 APN X 124133716 missense probably benign 0.00
IGL01125:Vmn2r121 APN X 124132807 missense probably damaging 0.99
IGL01450:Vmn2r121 APN X 124131191 missense possibly damaging 0.57
IGL01619:Vmn2r121 APN X 124132300 missense probably benign
IGL01797:Vmn2r121 APN X 124131351 splice site probably benign
IGL02227:Vmn2r121 APN X 124132681 missense probably benign 0.44
IGL02971:Vmn2r121 APN X 124127894 missense probably damaging 1.00
IGL03058:Vmn2r121 APN X 124132921 missense probably benign 0.00
IGL03142:Vmn2r121 APN X 124132938 missense possibly damaging 0.94
IGL03183:Vmn2r121 APN X 124132326 missense probably benign 0.03
E0370:Vmn2r121 UTSW X 124127920 missense probably benign 0.01
R0196:Vmn2r121 UTSW X 124132182 missense probably benign 0.03
R1381:Vmn2r121 UTSW X 124128140 missense probably damaging 1.00
R1399:Vmn2r121 UTSW X 124129848 missense possibly damaging 0.94
R1423:Vmn2r121 UTSW X 124129905 missense possibly damaging 0.52
R1687:Vmn2r121 UTSW X 124132791 missense probably benign 0.39
R2121:Vmn2r121 UTSW X 124133742 splice site probably null
R2124:Vmn2r121 UTSW X 124133742 splice site probably null
R3151:Vmn2r121 UTSW X 124131152 missense probably benign 0.20
R4735:Vmn2r121 UTSW X 124128638 missense probably benign
R5332:Vmn2r121 UTSW X 124133575 missense probably benign
R6102:Vmn2r121 UTSW X 124133575 missense probably benign
X0023:Vmn2r121 UTSW X 124135657 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ATGGTTTGCTGCAAGATGC -3'
(R):5'- CACAGACCAATCTTAAGTTAGTGG -3'

Sequencing Primer
(F):5'- AGACCTGGTTGGGATGTCC -3'
(R):5'- GACCAATCTTAAGTTAGTGGTTCTAC -3'
Posted On2015-07-21