Incidental Mutation 'R4462:Ccdc39'
ID330178
Institutional Source Beutler Lab
Gene Symbol Ccdc39
Ensembl Gene ENSMUSG00000027676
Gene Namecoiled-coil domain containing 39
Synonymsb2b2025.1Clo, b2b1735Clo, 4921507O14Rik, D3Ertd789e, b2b1304Clo
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.639) question?
Stock #R4462 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location33812362-33844310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33814668 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 798 (R798Q)
Ref Sequence ENSEMBL: ENSMUSP00000029222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029222] [ENSMUST00000099153] [ENSMUST00000108210] [ENSMUST00000117915] [ENSMUST00000199222]
Predicted Effect probably damaging
Transcript: ENSMUST00000029222
AA Change: R798Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029222
Gene: ENSMUSG00000027676
AA Change: R798Q

DomainStartEndE-ValueType
coiled coil region 16 67 N/A INTRINSIC
coiled coil region 164 198 N/A INTRINSIC
coiled coil region 232 339 N/A INTRINSIC
low complexity region 381 393 N/A INTRINSIC
internal_repeat_1 569 603 1.19e-5 PROSPERO
internal_repeat_1 598 635 1.19e-5 PROSPERO
coiled coil region 664 704 N/A INTRINSIC
coiled coil region 726 766 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
low complexity region 915 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099153
SMART Domains Protein: ENSMUSP00000096757
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108210
SMART Domains Protein: ENSMUSP00000103845
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
coiled coil region 415 476 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117915
SMART Domains Protein: ENSMUSP00000112450
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 254 287 6.19e-1 SMART
TPR 288 321 2.11e-3 SMART
TPR 329 362 1.88e0 SMART
coiled coil region 363 424 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197317
Predicted Effect probably benign
Transcript: ENSMUST00000199222
SMART Domains Protein: ENSMUSP00000142935
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200536
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the motility of cilia and flagella. The encoded protein is essential for the assembly of dynein regulatory and inner dynein arm complexes, which regulate ciliary beat. Defects in this gene are a cause of primary ciliary dyskinesia type 14 (CILD14). [provided by RefSeq, Jul 2011]
PHENOTYPE: ENU induced mutations result in situs inversus totalis with dextrocardia, double outlet right ventricle and atrial septal defects, renal anomalies including cysts and hydronephrosis, and immotile tracheal airway cilia. One ENU induced mutation causes ependymal motile cilia defects and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A T 6: 55,480,099 I272F possibly damaging Het
Adgrl3 C T 5: 81,688,510 A705V probably damaging Het
Arhgef12 A T 9: 42,981,982 V975E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Btnl6 A G 17: 34,508,057 S500P probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cdon T C 9: 35,457,580 V34A probably damaging Het
Defa17 A G 8: 21,656,537 R60G probably benign Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Fuca2 T C 10: 13,503,235 V41A probably damaging Het
Ggt6 C A 11: 72,437,828 H385N possibly damaging Het
Hgsnat G A 8: 25,954,636 T428I probably damaging Het
Nefh A G 11: 4,941,015 S535P probably damaging Het
Olfr1371 T A 11: 52,213,974 N5I probably damaging Het
Olfr905 T A 9: 38,473,064 F106I probably benign Het
Pkhd1l1 T C 15: 44,581,804 F3691L probably damaging Het
Polr2a T C 11: 69,746,403 D282G probably damaging Het
Ranbp17 T C 11: 33,217,421 probably null Het
Slc13a2 T C 11: 78,404,387 T187A probably benign Het
Slco3a1 A C 7: 74,554,563 S10A probably benign Het
Snph A T 2: 151,594,115 S229T probably damaging Het
Trim38 A G 13: 23,791,452 Y458C probably null Het
Ubr4 A G 4: 139,418,502 M1537V possibly damaging Het
Other mutations in Ccdc39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Ccdc39 APN 3 33832568 missense probably benign 0.16
IGL02321:Ccdc39 APN 3 33816958 unclassified probably benign
IGL02426:Ccdc39 APN 3 33825398 missense possibly damaging 0.85
IGL02930:Ccdc39 APN 3 33825494 missense probably damaging 1.00
IGL03027:Ccdc39 APN 3 33830118 missense probably benign 0.06
IGL03347:Ccdc39 APN 3 33837843 missense probably damaging 1.00
R0046:Ccdc39 UTSW 3 33844152 missense possibly damaging 0.52
R0046:Ccdc39 UTSW 3 33844152 missense possibly damaging 0.52
R0601:Ccdc39 UTSW 3 33819839 missense probably damaging 0.99
R0975:Ccdc39 UTSW 3 33844125 missense probably damaging 1.00
R1075:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1224:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1251:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1252:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1254:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1255:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1331:Ccdc39 UTSW 3 33815485 missense probably benign 0.34
R1370:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1385:Ccdc39 UTSW 3 33821412 missense probably damaging 0.99
R1416:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1491:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1513:Ccdc39 UTSW 3 33839145 missense possibly damaging 0.60
R1769:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1965:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1966:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R2061:Ccdc39 UTSW 3 33819896 missense probably damaging 0.97
R2109:Ccdc39 UTSW 3 33815501 missense probably damaging 0.97
R2183:Ccdc39 UTSW 3 33821432 missense possibly damaging 0.46
R2207:Ccdc39 UTSW 3 33836733 missense probably damaging 0.97
R2208:Ccdc39 UTSW 3 33841178 missense probably damaging 0.99
R2267:Ccdc39 UTSW 3 33815484 missense probably damaging 0.99
R3012:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R3013:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R3120:Ccdc39 UTSW 3 33837838 missense probably damaging 1.00
R3415:Ccdc39 UTSW 3 33814497 missense probably benign 0.02
R3802:Ccdc39 UTSW 3 33819895 missense probably damaging 1.00
R3804:Ccdc39 UTSW 3 33819895 missense probably damaging 1.00
R4107:Ccdc39 UTSW 3 33825479 missense probably damaging 1.00
R4334:Ccdc39 UTSW 3 33837882 missense probably damaging 1.00
R4367:Ccdc39 UTSW 3 33826522 missense probably benign 0.01
R4653:Ccdc39 UTSW 3 33819806 critical splice donor site probably null
R4723:Ccdc39 UTSW 3 33813078 missense possibly damaging 0.66
R4908:Ccdc39 UTSW 3 33839093 synonymous probably null
R5236:Ccdc39 UTSW 3 33830102 missense probably damaging 1.00
R5646:Ccdc39 UTSW 3 33825550 missense probably damaging 1.00
R5705:Ccdc39 UTSW 3 33816937 missense probably damaging 1.00
R5739:Ccdc39 UTSW 3 33826561 missense possibly damaging 0.95
R6130:Ccdc39 UTSW 3 33841192 splice site probably null
R6375:Ccdc39 UTSW 3 33814367 missense probably benign 0.38
R6548:Ccdc39 UTSW 3 33837959 missense probably benign 0.03
R6709:Ccdc39 UTSW 3 33830093 missense possibly damaging 0.52
R6858:Ccdc39 UTSW 3 33819868 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAGCTGAATGTCCTGTTC -3'
(R):5'- GCAAATGGCAAGCAATAAGTCTTC -3'

Sequencing Primer
(F):5'- AGCTGAATGTCCTGTTCTTCTAGAG -3'
(R):5'- GGACACTTAGCAAATAATGCC -3'
Posted On2015-07-21