Incidental Mutation 'R4462:Ranbp17'
ID330193
Institutional Source Beutler Lab
Gene Symbol Ranbp17
Ensembl Gene ENSMUSG00000040594
Gene NameRAN binding protein 17
Synonyms4932704E15Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.655) question?
Stock #R4462 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location33211795-33513746 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 33217421 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102815]
Predicted Effect probably null
Transcript: ENSMUST00000102815
SMART Domains Protein: ENSMUSP00000099879
Gene: ENSMUSG00000040594

DomainStartEndE-ValueType
IBN_N 30 95 3.24e-5 SMART
low complexity region 270 283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131851
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-17 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A T 6: 55,480,099 I272F possibly damaging Het
Adgrl3 C T 5: 81,688,510 A705V probably damaging Het
Arhgef12 A T 9: 42,981,982 V975E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Btnl6 A G 17: 34,508,057 S500P probably damaging Het
Ccdc39 C T 3: 33,814,668 R798Q probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cdon T C 9: 35,457,580 V34A probably damaging Het
Defa17 A G 8: 21,656,537 R60G probably benign Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Fuca2 T C 10: 13,503,235 V41A probably damaging Het
Ggt6 C A 11: 72,437,828 H385N possibly damaging Het
Hgsnat G A 8: 25,954,636 T428I probably damaging Het
Nefh A G 11: 4,941,015 S535P probably damaging Het
Olfr1371 T A 11: 52,213,974 N5I probably damaging Het
Olfr905 T A 9: 38,473,064 F106I probably benign Het
Pkhd1l1 T C 15: 44,581,804 F3691L probably damaging Het
Polr2a T C 11: 69,746,403 D282G probably damaging Het
Slc13a2 T C 11: 78,404,387 T187A probably benign Het
Slco3a1 A C 7: 74,554,563 S10A probably benign Het
Snph A T 2: 151,594,115 S229T probably damaging Het
Trim38 A G 13: 23,791,452 Y458C probably null Het
Ubr4 A G 4: 139,418,502 M1537V possibly damaging Het
Other mutations in Ranbp17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ranbp17 APN 11 33493402 missense probably benign 0.13
IGL00582:Ranbp17 APN 11 33504683 missense probably damaging 0.99
IGL00698:Ranbp17 APN 11 33441910 missense probably benign 0.00
IGL00789:Ranbp17 APN 11 33243249 missense probably benign 0.27
IGL01304:Ranbp17 APN 11 33266147 missense possibly damaging 0.91
IGL01936:Ranbp17 APN 11 33487689 missense probably benign 0.00
IGL01937:Ranbp17 APN 11 33328520 missense possibly damaging 0.73
IGL01945:Ranbp17 APN 11 33328520 missense possibly damaging 0.73
IGL01993:Ranbp17 APN 11 33500770 missense possibly damaging 0.48
IGL02588:Ranbp17 APN 11 33217361 missense probably benign
IGL02870:Ranbp17 APN 11 33243262 missense probably damaging 1.00
IGL03149:Ranbp17 APN 11 33243183 missense possibly damaging 0.76
R0079:Ranbp17 UTSW 11 33500682 missense probably damaging 1.00
R0349:Ranbp17 UTSW 11 33500689 missense probably benign
R0395:Ranbp17 UTSW 11 33474896 missense probably benign
R1456:Ranbp17 UTSW 11 33266310 missense probably damaging 1.00
R1539:Ranbp17 UTSW 11 33297394 missense probably damaging 0.99
R1542:Ranbp17 UTSW 11 33264672 missense probably benign
R1770:Ranbp17 UTSW 11 33217301 missense probably benign 0.31
R2216:Ranbp17 UTSW 11 33481125 missense probably damaging 1.00
R2656:Ranbp17 UTSW 11 33243122 missense probably benign
R2883:Ranbp17 UTSW 11 33504708 missense probably damaging 1.00
R3498:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3499:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3721:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3788:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3790:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3914:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R3915:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R3949:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4021:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4022:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4027:Ranbp17 UTSW 11 33500718 missense possibly damaging 0.67
R4421:Ranbp17 UTSW 11 33475056 missense probably benign 0.01
R4659:Ranbp17 UTSW 11 33266288 missense probably damaging 1.00
R4791:Ranbp17 UTSW 11 33487746 missense probably benign 0.11
R4837:Ranbp17 UTSW 11 33328451 missense probably damaging 1.00
R4914:Ranbp17 UTSW 11 33213425 missense probably benign
R4939:Ranbp17 UTSW 11 33219223 missense probably benign 0.31
R5119:Ranbp17 UTSW 11 33404181 makesense probably null
R5171:Ranbp17 UTSW 11 33217419 missense probably benign
R5182:Ranbp17 UTSW 11 33219287 intron probably benign
R5288:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5384:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5385:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5398:Ranbp17 UTSW 11 33474998 missense probably damaging 1.00
R6658:Ranbp17 UTSW 11 33219214 nonsense probably null
R6701:Ranbp17 UTSW 11 33475066 missense probably damaging 1.00
R6796:Ranbp17 UTSW 11 33217398 missense probably benign
R6869:Ranbp17 UTSW 11 33513074 start gained probably benign
X0013:Ranbp17 UTSW 11 33289562 unclassified probably null
X0024:Ranbp17 UTSW 11 33213404 makesense probably null
Predicted Primers PCR Primer
(F):5'- TTCTTTCCAACAGACCTGGAGTG -3'
(R):5'- ACAGTCACAGCACCGGATTC -3'

Sequencing Primer
(F):5'- TGGAGTGCCCCCAGAGG -3'
(R):5'- GTCACAGCACCGGATTCTAATGAG -3'
Posted On2015-07-21