Mutagenetix > Incidental Mutation

Incidental Mutation 'R4462:Or2y6'

330194

Institutional Source

Beutler Lab

Gene Symbol

Or2y6

Ensembl Gene

ENSMUSG00000060170

Gene Name

olfactory receptor family 2 subfamily Y member 6

Synonyms

GA_x6K02T2QP88-3214035-3214970, MOR256-58, Olfr1371

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R4462 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52103879-52104814 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 52104801 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 5 (N5I)

Ref Sequence

ENSEMBL: ENSMUSP00000075241 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075844]

AlphaFold

Q7TQT7

Predicted Effect

probably damaging
Transcript: ENSMUST00000075844
AA Change: N5I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075241
Gene: ENSMUSG00000060170
AA Change: N5I

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	7.9e-48	PFAM
Pfam:7tm_1	41	289	5.1e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181262

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcyap1r1	A	T	6: 55,457,084 (GRCm39)	I272F	possibly damaging	Het
Adgrl3	C	T	5: 81,836,357 (GRCm39)	A705V	probably damaging	Het
Arhgef12	A	T	9: 42,893,278 (GRCm39)	V975E	probably damaging	Het
Bahd1	C	T	2: 118,746,887 (GRCm39)	P169S	probably damaging	Het
Btnl6	A	G	17: 34,727,031 (GRCm39)	S500P	probably damaging	Het
Ccdc39	C	T	3: 33,868,817 (GRCm39)	R798Q	probably damaging	Het
Cdkn2d	C	G	9: 21,202,185 (GRCm39)	V21L	probably benign	Het
Cdon	T	C	9: 35,368,876 (GRCm39)	V34A	probably damaging	Het
Defa17	A	G	8: 22,146,553 (GRCm39)	R60G	probably benign	Het
Egr2	GAA	GA	10: 67,375,733 (GRCm39)		probably null	Het
Fuca2	T	C	10: 13,378,979 (GRCm39)	V41A	probably damaging	Het
Ggt6	C	A	11: 72,328,654 (GRCm39)	H385N	possibly damaging	Het
Hgsnat	G	A	8: 26,444,664 (GRCm39)	T428I	probably damaging	Het
Nefh	A	G	11: 4,891,015 (GRCm39)	S535P	probably damaging	Het
Or8b1c	T	A	9: 38,384,360 (GRCm39)	F106I	probably benign	Het
Pkhd1l1	T	C	15: 44,445,200 (GRCm39)	F3691L	probably damaging	Het
Polr2a	T	C	11: 69,637,229 (GRCm39)	D282G	probably damaging	Het
Ranbp17	T	C	11: 33,167,421 (GRCm39)		probably null	Het
Slc13a2	T	C	11: 78,295,213 (GRCm39)	T187A	probably benign	Het
Slco3a1	A	C	7: 74,204,311 (GRCm39)	S10A	probably benign	Het
Snph	A	T	2: 151,436,035 (GRCm39)	S229T	probably damaging	Het
Trim38	A	G	13: 23,975,435 (GRCm39)	Y458C	probably null	Het
Ubr4	A	G	4: 139,145,813 (GRCm39)	M1537V	possibly damaging	Het

Other mutations in Or2y6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0513:Or2y6	UTSW	11	52,104,576 (GRCm39)	missense	possibly damaging	0.94
R4567:Or2y6	UTSW	11	52,104,291 (GRCm39)	missense	probably damaging	1.00
R4621:Or2y6	UTSW	11	52,104,706 (GRCm39)	missense	probably benign	0.26
R5846:Or2y6	UTSW	11	52,103,881 (GRCm39)	makesense	probably null
R5873:Or2y6	UTSW	11	52,104,180 (GRCm39)	missense	probably damaging	1.00
R8181:Or2y6	UTSW	11	52,104,096 (GRCm39)	missense	probably damaging	1.00
Z1177:Or2y6	UTSW	11	52,104,237 (GRCm39)	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CTGTCAAGTCCAGAGAGGTTGAC -3'
(R):5'- CAACAGGATTGAGTAGAGTAGCAACTC -3'

Sequencing Primer
(F):5'- CTGGCAGTGTAGCAGAGGTC -3'
(R):5'- TATGTGGGTCCTCTGCAA -3'

Posted On

2015-07-21