Incidental Mutation 'R4462:Trim38'
ID330199
Institutional Source Beutler Lab
Gene Symbol Trim38
Ensembl Gene ENSMUSG00000064140
Gene Nametripartite motif-containing 38
SynonymsLOC214158
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.044) question?
Stock #R4462 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23769913-23791528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23791452 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 458 (Y458C)
Ref Sequence ENSEMBL: ENSMUSP00000153240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074067] [ENSMUST00000223911] [ENSMUST00000226039]
Predicted Effect probably null
Transcript: ENSMUST00000074067
AA Change: Y458C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073709
Gene: ENSMUSG00000064140
AA Change: Y458C

DomainStartEndE-ValueType
RING 16 61 8.95e-7 SMART
BBOX 90 131 4.34e-5 SMART
coiled coil region 202 249 N/A INTRINSIC
PRY 293 347 2.31e-9 SMART
SPRY 348 469 6.71e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144770
Predicted Effect probably benign
Transcript: ENSMUST00000223911
Predicted Effect probably null
Transcript: ENSMUST00000226039
AA Change: Y458C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The encoded protein contains a RING-type zinc finger, B box-type zinc finger and SPRY domain. The function of this protein has not been identified. A pseudogene of this gene is located on the long arm of chromosome 4. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased poly(I:C) and LPS-induced IFN-beta, TNFalpha and IL6 with increased induced mortality induced by poly(I:C), LPS or S. typhimurium infection, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A T 6: 55,480,099 I272F possibly damaging Het
Adgrl3 C T 5: 81,688,510 A705V probably damaging Het
Arhgef12 A T 9: 42,981,982 V975E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Btnl6 A G 17: 34,508,057 S500P probably damaging Het
Ccdc39 C T 3: 33,814,668 R798Q probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cdon T C 9: 35,457,580 V34A probably damaging Het
Defa17 A G 8: 21,656,537 R60G probably benign Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Fuca2 T C 10: 13,503,235 V41A probably damaging Het
Ggt6 C A 11: 72,437,828 H385N possibly damaging Het
Hgsnat G A 8: 25,954,636 T428I probably damaging Het
Nefh A G 11: 4,941,015 S535P probably damaging Het
Olfr1371 T A 11: 52,213,974 N5I probably damaging Het
Olfr905 T A 9: 38,473,064 F106I probably benign Het
Pkhd1l1 T C 15: 44,581,804 F3691L probably damaging Het
Polr2a T C 11: 69,746,403 D282G probably damaging Het
Ranbp17 T C 11: 33,217,421 probably null Het
Slc13a2 T C 11: 78,404,387 T187A probably benign Het
Slco3a1 A C 7: 74,554,563 S10A probably benign Het
Snph A T 2: 151,594,115 S229T probably damaging Het
Ubr4 A G 4: 139,418,502 M1537V possibly damaging Het
Other mutations in Trim38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Trim38 APN 13 23791032 missense possibly damaging 0.91
IGL01592:Trim38 APN 13 23791427 missense possibly damaging 0.85
IGL02339:Trim38 APN 13 23788230 missense probably damaging 1.00
IGL03062:Trim38 APN 13 23782963 missense probably damaging 1.00
IGL03278:Trim38 APN 13 23790996 missense possibly damaging 0.65
R0630:Trim38 UTSW 13 23791132 nonsense probably null
R1263:Trim38 UTSW 13 23791134 missense probably damaging 1.00
R1560:Trim38 UTSW 13 23782702 missense probably benign 0.02
R1978:Trim38 UTSW 13 23791098 missense probably damaging 1.00
R4407:Trim38 UTSW 13 23791491 missense probably benign 0.04
R4649:Trim38 UTSW 13 23782969 missense probably damaging 1.00
R4651:Trim38 UTSW 13 23782969 missense probably damaging 1.00
R4653:Trim38 UTSW 13 23782969 missense probably damaging 1.00
R4816:Trim38 UTSW 13 23788281 missense probably damaging 1.00
R4970:Trim38 UTSW 13 23791329 missense probably damaging 0.98
R5946:Trim38 UTSW 13 23782734 missense probably benign 0.04
R6538:Trim38 UTSW 13 23785949 missense probably damaging 0.97
R6974:Trim38 UTSW 13 23789519 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACGGCCTTGAAGCTCTTACTTC -3'
(R):5'- TTCAAACACAGGGATCGTGC -3'

Sequencing Primer
(F):5'- GGCCTTGAAGCTCTTACTTCTACCC -3'
(R):5'- TTCAAACACAGGGATCGTGCAATATG -3'
Posted On2015-07-21