Incidental Mutation 'R4463:Olfr352'
ID330208
Institutional Source Beutler Lab
Gene Symbol Olfr352
Ensembl Gene ENSMUSG00000053146
Gene Nameolfactory receptor 352
SynonymsGA_x6K02T2NLDC-33564136-33565083, MOR136-10
MMRRC Submission 041721-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4463 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36868460-36872785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36870193 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 209 (I209T)
Ref Sequence ENSEMBL: ENSMUSP00000149568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065416] [ENSMUST00000217325]
Predicted Effect probably benign
Transcript: ENSMUST00000065416
AA Change: I209T

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000070758
Gene: ENSMUSG00000053146
AA Change: I209T

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.4e-56 PFAM
Pfam:7TM_GPCR_Srsx 38 308 1.8e-7 PFAM
Pfam:7tm_1 44 293 1.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217325
AA Change: I209T

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1312 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,150,719 M1197V probably benign Het
Abcb1a T C 5: 8,719,981 probably benign Het
Abcc8 T C 7: 46,106,581 probably null Het
Alox12e A G 11: 70,318,256 L388P probably damaging Het
Aspm T A 1: 139,455,010 S27T possibly damaging Het
Capn2 G A 1: 182,479,764 probably benign Het
Catspere1 G A 1: 177,937,713 noncoding transcript Het
Ccdc158 T C 5: 92,634,300 D820G probably null Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Chd9 T A 8: 90,978,999 D761E probably benign Het
Chst8 T C 7: 34,675,220 D398G probably damaging Het
Clns1a T C 7: 97,720,949 probably benign Het
Cyp3a57 A T 5: 145,381,274 Y355F probably damaging Het
Cyp4f37 A G 17: 32,627,736 probably null Het
Eipr1 G A 12: 28,859,339 A202T probably damaging Het
Fam83a T C 15: 57,995,259 S232P probably damaging Het
Fastkd2 C T 1: 63,735,809 probably benign Het
Fgfr4 G A 13: 55,156,467 V107I probably benign Het
Gatad1 G T 5: 3,647,404 S72R probably benign Het
Gli2 T C 1: 118,836,008 D1471G probably damaging Het
Gm1330 A T 2: 149,003,144 Y36* probably null Het
Gm2056 A G 12: 88,027,359 D119G probably benign Het
Gm29125 T C 1: 80,383,186 noncoding transcript Het
Idi1 G A 13: 8,887,472 probably benign Het
Itgbl1 C T 14: 123,840,668 T190I probably damaging Het
Kbtbd3 G A 9: 4,331,257 G544R probably damaging Het
Kifc3 T C 8: 95,102,116 T638A probably damaging Het
Lama1 G A 17: 67,761,700 C798Y probably damaging Het
Larp6 C A 9: 60,736,996 H140N probably damaging Het
Mctp1 A T 13: 76,712,087 D108V probably damaging Het
Myzap G T 9: 71,555,651 D204E probably benign Het
Neb GCC GC 2: 52,279,722 probably null Het
Olfr1189 T C 2: 88,592,632 V276A possibly damaging Het
Olfr1340 T C 4: 118,726,658 V137A probably benign Het
Phka1 A G X: 102,545,384 V818A probably benign Het
Plek T C 11: 16,981,873 Y326C possibly damaging Het
Pp2d1 A G 17: 53,515,858 I60T probably benign Het
Prmt3 T C 7: 49,818,089 Y348H probably damaging Het
Psg27 G T 7: 18,557,085 Q398K possibly damaging Het
Raver1 T C 9: 21,091,827 T51A probably benign Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Sectm1a T A 11: 121,069,651 I113L probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Snph A T 2: 151,594,115 S229T probably damaging Het
Stpg4 A G 17: 87,389,673 F183L probably benign Het
Tango6 A T 8: 106,689,074 T176S probably benign Het
Vmn1r196 A G 13: 22,293,683 Q164R probably benign Het
Vstm4 T A 14: 32,917,876 L236Q probably damaging Het
Xylb A G 9: 119,386,367 D462G probably benign Het
Zc2hc1c A G 12: 85,290,297 R243G probably damaging Het
Other mutations in Olfr352
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Olfr352 APN 2 36870210 missense probably benign 0.01
IGL01538:Olfr352 APN 2 36870520 utr 3 prime probably benign
IGL01716:Olfr352 APN 2 36869667 missense probably benign 0.11
IGL01735:Olfr352 APN 2 36869686 missense possibly damaging 0.95
IGL01998:Olfr352 APN 2 36869646 missense probably benign 0.01
IGL02820:Olfr352 APN 2 36869859 missense probably benign 0.01
IGL03267:Olfr352 APN 2 36870501 missense probably benign 0.00
IGL03306:Olfr352 APN 2 36870525 utr 3 prime probably benign
R0013:Olfr352 UTSW 2 36870160 missense probably damaging 1.00
R0081:Olfr352 UTSW 2 36870010 missense possibly damaging 0.58
R0421:Olfr352 UTSW 2 36869641 missense possibly damaging 0.89
R1613:Olfr352 UTSW 2 36870393 missense possibly damaging 0.91
R1842:Olfr352 UTSW 2 36869589 missense probably damaging 1.00
R2698:Olfr352 UTSW 2 36870196 missense possibly damaging 0.94
R4993:Olfr352 UTSW 2 36869988 missense probably benign 0.30
R5553:Olfr352 UTSW 2 36870465 missense probably benign 0.00
R5666:Olfr352 UTSW 2 36870389 missense probably benign 0.11
R5934:Olfr352 UTSW 2 36870268 missense probably benign 0.34
R6290:Olfr352 UTSW 2 36870436 missense probably damaging 1.00
R6312:Olfr352 UTSW 2 36870465 missense probably benign 0.02
R7358:Olfr352 UTSW 2 36869878 missense probably benign
X0022:Olfr352 UTSW 2 36870277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACCATCATGAGTCAGAGTC -3'
(R):5'- GATTCAGCATGGGTGTGACC -3'

Sequencing Primer
(F):5'- ACCATCATGAGTCAGAGTCTCTGTG -3'
(R):5'- GGTGTGACCATAGTGTACATCAC -3'
Posted On2015-07-21