Incidental Mutation 'R0052:Ralgds'
ID33021
Institutional Source Beutler Lab
Gene Symbol Ralgds
Ensembl Gene ENSMUSG00000026821
Gene Nameral guanine nucleotide dissociation stimulator
SynonymsRalGDS, Gnds, Rgds
MMRRC Submission 038346-MU
Accession Numbers

Ncbi RefSeq: NM_001145835.1, NM_001145836.1, NM_009058.2, NM_001145834.1; MGI:107485

Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R0052 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location28513125-28553081 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 28544388 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028170] [ENSMUST00000100241] [ENSMUST00000113893] [ENSMUST00000135803] [ENSMUST00000140704]
Predicted Effect probably null
Transcript: ENSMUST00000028170
SMART Domains Protein: ENSMUSP00000028170
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 56 194 4.02e-37 SMART
low complexity region 239 285 N/A INTRINSIC
RasGEF 320 587 5.28e-118 SMART
low complexity region 613 626 N/A INTRINSIC
low complexity region 646 655 N/A INTRINSIC
low complexity region 683 712 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
RA 736 823 6.51e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100241
SMART Domains Protein: ENSMUSP00000097812
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 111 249 4.02e-37 SMART
low complexity region 294 340 N/A INTRINSIC
RasGEF 375 642 5.28e-118 SMART
low complexity region 668 681 N/A INTRINSIC
low complexity region 701 710 N/A INTRINSIC
low complexity region 738 767 N/A INTRINSIC
low complexity region 771 781 N/A INTRINSIC
RA 791 878 6.51e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113893
SMART Domains Protein: ENSMUSP00000109526
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 111 237 1.25e-42 SMART
low complexity region 282 328 N/A INTRINSIC
RasGEF 363 630 5.28e-118 SMART
low complexity region 656 669 N/A INTRINSIC
low complexity region 689 698 N/A INTRINSIC
low complexity region 726 755 N/A INTRINSIC
low complexity region 759 769 N/A INTRINSIC
RA 779 866 6.51e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130281
Predicted Effect probably benign
Transcript: ENSMUST00000135803
SMART Domains Protein: ENSMUSP00000115092
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 56 127 2.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137215
SMART Domains Protein: ENSMUSP00000116215
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 1 107 5.55e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137513
Predicted Effect probably benign
Transcript: ENSMUST00000140704
SMART Domains Protein: ENSMUSP00000118966
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
RA 36 123 6.51e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146217
Meta Mutation Damage Score 0.566 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 97% (65/67)
MGI Phenotype Strain: 3574574
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide dissociation stimulators (GDSs, or exchange factors), such as RALGDS, are effectors of Ras-related GTPases (see MIM 190020) that participate in signaling for a variety of cellular processes.[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous mutant mice exhibit reduced tumor incidence, size and progression to malignancy in multistage skin carcinogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(5) Gene trapped(11)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,915,951 S438P possibly damaging Het
Atp2a1 A G 7: 126,457,897 probably benign Het
Axin2 T C 11: 108,949,270 Y735H probably damaging Het
Bicd2 T A 13: 49,375,314 L184Q probably damaging Het
Bub1 G A 2: 127,809,039 T618I probably benign Het
Catsperg2 A G 7: 29,725,020 probably benign Het
Ccdc73 T A 2: 104,929,570 probably benign Het
Crybg3 A T 16: 59,565,656 probably benign Het
Dsp A G 13: 38,197,364 D2096G possibly damaging Het
Eef2 C CN 10: 81,178,768 probably null Het
Elp3 A G 14: 65,531,526 *548Q probably null Het
Eno4 A G 19: 58,968,553 D357G probably damaging Het
Fam214a A G 9: 75,018,983 probably benign Het
Fcrls A T 3: 87,256,778 I348N possibly damaging Het
Fgl2 A T 5: 21,375,349 S230C probably damaging Het
Ginm1 T A 10: 7,779,306 E57D possibly damaging Het
Gtf3c1 A T 7: 125,667,971 probably null Het
Herc1 G T 9: 66,400,156 G1044V probably damaging Het
Hmcn1 G A 1: 150,677,406 T2511M probably damaging Het
Iba57 C T 11: 59,158,901 A207T probably benign Het
Itga9 T A 9: 118,636,549 I157N probably damaging Het
Kalrn A G 16: 34,357,171 L208P probably damaging Het
Kcnj10 A G 1: 172,368,924 T2A probably benign Het
Kdm1b T A 13: 47,064,117 C351S probably damaging Het
Kif21a T C 15: 90,970,857 E700G probably damaging Het
Mmd C T 11: 90,259,998 probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Morn3 T C 5: 123,046,663 Y38C probably damaging Het
Nacc1 A T 8: 84,676,225 V313D probably benign Het
Nbeal1 T A 1: 60,228,612 probably benign Het
Neb T C 2: 52,273,980 K1989E possibly damaging Het
Nlrp3 C T 11: 59,565,128 R917* probably null Het
Nlrp4b T A 7: 10,725,962 Y463* probably null Het
Perm1 A T 4: 156,218,115 D372V probably damaging Het
Phf3 T C 1: 30,808,767 T1232A probably damaging Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Pld4 T A 12: 112,767,857 F386I probably benign Het
Prex2 T A 1: 11,160,156 L802Q probably damaging Het
Psd3 A G 8: 67,882,979 probably null Het
Rmdn2 A G 17: 79,650,331 E16G probably damaging Het
Rnf111 A T 9: 70,476,389 S87R probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc9c1 A G 16: 45,606,856 probably benign Het
Slco3a1 A T 7: 74,504,326 I166N probably benign Het
Snx5 A T 2: 144,259,192 probably null Het
Srgap1 T C 10: 121,800,827 D741G possibly damaging Het
St8sia2 G T 7: 73,943,290 Y339* probably null Het
St8sia2 A T 7: 73,971,952 W86R probably damaging Het
Stk33 A G 7: 109,279,669 L491P possibly damaging Het
Sult2a7 T C 7: 14,465,208 Y298C probably damaging Het
Tdo2 T A 3: 81,967,025 N210I probably benign Het
Thada A T 17: 84,455,158 N104K probably damaging Het
Timm8b A T 9: 50,605,030 D61V possibly damaging Het
Tshz1 G A 18: 84,014,945 T446I possibly damaging Het
Ubap2l T C 3: 90,038,928 N123S possibly damaging Het
Vmn1r48 T C 6: 90,036,264 E193G possibly damaging Het
Vmn1r69 C T 7: 10,580,400 V135I probably benign Het
Vmn2r103 G T 17: 19,811,641 G559V probably benign Het
Vmn2r26 T A 6: 124,062,033 *856R probably null Het
Vmn2r88 A G 14: 51,418,700 I798V possibly damaging Het
Vsir C T 10: 60,358,082 A108V probably benign Het
Zfp14 G T 7: 30,038,328 Q411K probably damaging Het
Zfp236 A T 18: 82,639,332 M762K probably damaging Het
Zfp462 G A 4: 55,011,762 G1243S probably benign Het
Other mutations in Ralgds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Ralgds APN 2 28552218 missense probably damaging 1.00
IGL01774:Ralgds APN 2 28550542 nonsense probably null
IGL02747:Ralgds APN 2 28548110 unclassified probably benign
IGL03135:Ralgds APN 2 28549088 missense probably damaging 0.99
PIT4458001:Ralgds UTSW 2 28542474 missense probably damaging 1.00
PIT4531001:Ralgds UTSW 2 28545214 nonsense probably null
R0049:Ralgds UTSW 2 28542379 synonymous silent
R0052:Ralgds UTSW 2 28544388 critical splice donor site probably null
R0285:Ralgds UTSW 2 28550569 splice site probably null
R0665:Ralgds UTSW 2 28545206 missense probably damaging 0.98
R0718:Ralgds UTSW 2 28549116 missense probably benign 0.37
R1755:Ralgds UTSW 2 28550546 missense probably damaging 0.99
R1966:Ralgds UTSW 2 28545875 missense probably damaging 0.96
R2873:Ralgds UTSW 2 28548769 splice site probably null
R2874:Ralgds UTSW 2 28548769 splice site probably null
R4082:Ralgds UTSW 2 28552271 utr 3 prime probably benign
R4342:Ralgds UTSW 2 28552095 missense probably damaging 1.00
R4344:Ralgds UTSW 2 28552095 missense probably damaging 1.00
R4647:Ralgds UTSW 2 28545520 critical splice donor site probably null
R4738:Ralgds UTSW 2 28545416 missense probably damaging 1.00
R4762:Ralgds UTSW 2 28552152 missense probably damaging 0.97
R5027:Ralgds UTSW 2 28552090 critical splice acceptor site probably null
R5320:Ralgds UTSW 2 28545212 missense probably damaging 1.00
R5738:Ralgds UTSW 2 28542526 intron probably benign
R5969:Ralgds UTSW 2 28542414 missense probably damaging 1.00
R6014:Ralgds UTSW 2 28543661 missense probably damaging 0.97
R6136:Ralgds UTSW 2 28550565 critical splice donor site probably null
R6137:Ralgds UTSW 2 28547588 missense probably damaging 0.99
R6583:Ralgds UTSW 2 28533644 missense probably damaging 0.99
R6618:Ralgds UTSW 2 28550511 missense probably benign 0.09
R6801:Ralgds UTSW 2 28548436 missense probably damaging 1.00
R7046:Ralgds UTSW 2 28540729 missense probably damaging 1.00
R7095:Ralgds UTSW 2 28549308 missense possibly damaging 0.83
R7276:Ralgds UTSW 2 28545872 missense probably damaging 1.00
X0028:Ralgds UTSW 2 28548699 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACATCAACTCCAGTACGAGAGC -3'
(R):5'- TTCATAAATGCTGAGGTTAGACGGGC -3'

Sequencing Primer
(F):5'- CTGAGCTAGAACCAGTTCCAGAG -3'
(R):5'- cacacacacacacacacac -3'
Posted On2013-05-09