Incidental Mutation 'R4463:Phka1'
ID330255
Institutional Source Beutler Lab
Gene Symbol Phka1
Ensembl Gene ENSMUSG00000034055
Gene Namephosphorylase kinase alpha 1
Synonyms9830108K24Rik, Phka
MMRRC Submission 041721-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4463 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location102513975-102644246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102545384 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 818 (V818A)
Ref Sequence ENSEMBL: ENSMUSP00000112529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043596] [ENSMUST00000052012] [ENSMUST00000113611] [ENSMUST00000119229] [ENSMUST00000120270] [ENSMUST00000122022]
Predicted Effect probably benign
Transcript: ENSMUST00000043596
AA Change: V759A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042778
Gene: ENSMUSG00000034055
AA Change: V759A

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 864 5.6e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052012
AA Change: V818A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061991
Gene: ENSMUSG00000034055
AA Change: V818A

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 6.8e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113611
AA Change: V818A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109241
Gene: ENSMUSG00000034055
AA Change: V818A

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 6.5e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119229
AA Change: V818A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114066
Gene: ENSMUSG00000034055
AA Change: V818A

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 7e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120270
AA Change: V818A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113302
Gene: ENSMUSG00000034055
AA Change: V818A

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 7.3e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122022
AA Change: V818A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112529
Gene: ENSMUSG00000034055
AA Change: V818A

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 7.6e-196 PFAM
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, and the skeletal muscle isoform is encoded by this gene. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, which are encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9D, also known as X-linked muscle glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. A pseudogene has been found on chromosome 1.[provided by RefSeq, Feb 2010]
PHENOTYPE: PHK activity is nearly absent in I/Ln skeletal muscle and reduced in brain, heart and kidney. The I-allele sequence is known to have a single nucleotide insertion (frameshift). A different allele in strain V reduces PHK activity to 25% and is dominant tonormal and I-strain alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,150,719 M1197V probably benign Het
Abcb1a T C 5: 8,719,981 probably benign Het
Abcc8 T C 7: 46,106,581 probably null Het
Alox12e A G 11: 70,318,256 L388P probably damaging Het
Aspm T A 1: 139,455,010 S27T possibly damaging Het
Capn2 G A 1: 182,479,764 probably benign Het
Catspere1 G A 1: 177,937,713 noncoding transcript Het
Ccdc158 T C 5: 92,634,300 D820G probably null Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Chd9 T A 8: 90,978,999 D761E probably benign Het
Chst8 T C 7: 34,675,220 D398G probably damaging Het
Clns1a T C 7: 97,720,949 probably benign Het
Cyp3a57 A T 5: 145,381,274 Y355F probably damaging Het
Cyp4f37 A G 17: 32,627,736 probably null Het
Eipr1 G A 12: 28,859,339 A202T probably damaging Het
Fam83a T C 15: 57,995,259 S232P probably damaging Het
Fastkd2 C T 1: 63,735,809 probably benign Het
Fgfr4 G A 13: 55,156,467 V107I probably benign Het
Gatad1 G T 5: 3,647,404 S72R probably benign Het
Gli2 T C 1: 118,836,008 D1471G probably damaging Het
Gm1330 A T 2: 149,003,144 Y36* probably null Het
Gm2056 A G 12: 88,027,359 D119G probably benign Het
Gm29125 T C 1: 80,383,186 noncoding transcript Het
Idi1 G A 13: 8,887,472 probably benign Het
Itgbl1 C T 14: 123,840,668 T190I probably damaging Het
Kbtbd3 G A 9: 4,331,257 G544R probably damaging Het
Kifc3 T C 8: 95,102,116 T638A probably damaging Het
Lama1 G A 17: 67,761,700 C798Y probably damaging Het
Larp6 C A 9: 60,736,996 H140N probably damaging Het
Mctp1 A T 13: 76,712,087 D108V probably damaging Het
Myzap G T 9: 71,555,651 D204E probably benign Het
Neb GCC GC 2: 52,279,722 probably null Het
Olfr1189 T C 2: 88,592,632 V276A possibly damaging Het
Olfr1340 T C 4: 118,726,658 V137A probably benign Het
Olfr352 T C 2: 36,870,193 I209T probably benign Het
Plek T C 11: 16,981,873 Y326C possibly damaging Het
Pp2d1 A G 17: 53,515,858 I60T probably benign Het
Prmt3 T C 7: 49,818,089 Y348H probably damaging Het
Psg27 G T 7: 18,557,085 Q398K possibly damaging Het
Raver1 T C 9: 21,091,827 T51A probably benign Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Sectm1a T A 11: 121,069,651 I113L probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Snph A T 2: 151,594,115 S229T probably damaging Het
Stpg4 A G 17: 87,389,673 F183L probably benign Het
Tango6 A T 8: 106,689,074 T176S probably benign Het
Vmn1r196 A G 13: 22,293,683 Q164R probably benign Het
Vstm4 T A 14: 32,917,876 L236Q probably damaging Het
Xylb A G 9: 119,386,367 D462G probably benign Het
Zc2hc1c A G 12: 85,290,297 R243G probably damaging Het
Other mutations in Phka1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Phka1 APN X 102586106 missense probably damaging 0.99
IGL02561:Phka1 APN X 102598289 splice site probably benign
IGL03201:Phka1 APN X 102541110 critical splice donor site probably null
IGL03294:Phka1 APN X 102537213 missense probably damaging 1.00
R0626:Phka1 UTSW X 102520831 missense probably damaging 1.00
R0635:Phka1 UTSW X 102621400 missense probably damaging 1.00
R0709:Phka1 UTSW X 102586104 missense probably damaging 0.98
R1399:Phka1 UTSW X 102617358 missense probably damaging 1.00
R2114:Phka1 UTSW X 102610201 missense probably damaging 1.00
R2115:Phka1 UTSW X 102610201 missense probably damaging 1.00
R2117:Phka1 UTSW X 102610201 missense probably damaging 1.00
R2267:Phka1 UTSW X 102541110 critical splice donor site probably benign
R2268:Phka1 UTSW X 102541110 critical splice donor site probably benign
X0022:Phka1 UTSW X 102621345 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCCACTCACGAATAAAAGGC -3'
(R):5'- CTACTAAAGGAGGTTACAACAAGC -3'

Sequencing Primer
(F):5'- TTGAACCCAGGATCCCAGGAATG -3'
(R):5'- AGGAGGTTACAACAAGCATATCC -3'
Posted On2015-07-21