Incidental Mutation 'R4464:0610040J01Rik'
List |< first << previous [record 75 of 386652] next >> last >|
ID330267
Institutional Source Beutler Lab
Gene Symbol 0610040J01Rik
Ensembl Gene ENSMUSG00000060512
Gene NameRIKEN cDNA 0610040J01 gene
Synonyms
MMRRC Submission
Accession Numbers
Stock #R4464 (G1)
Quality Score186
Status Validated
Chromosome5
Chromosomal Location63812495-63899619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63898839 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 306 (G306V)
Ref Sequence ENSEMBL: ENSMUSP00000080443 (fasta)
Gene Model predicted sequence gene model
Predicted Effect unknown
Transcript: ENSMUST00000081747
AA Change: G306V
SMART Domains Protein: ENSMUSP00000080443
Gene: ENSMUSG00000060512
AA Change: G306V

DomainStartEndE-ValueType
Pfam:DUF4699 9 313 2.5e-123 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,358,786 V1110A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Aldh8a1 C A 10: 21,388,941 A197E probably benign Het
Alms1 A G 6: 85,620,021 T610A probably benign Het
Armc3 T C 2: 19,248,659 Y204H probably damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cst12 G A 2: 148,789,517 V53I possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dennd1a A T 2: 38,243,390 I62N noncoding transcript Het
Fam213a T A 14: 40,997,875 K127N probably damaging Het
Gm7535 C A 17: 17,911,662 V96L possibly damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ifngr1 G A 10: 19,597,517 V72I possibly damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Krt86 G A 15: 101,473,914 D122N probably damaging Het
Lrrcc1 A G 3: 14,557,318 K273E probably damaging Het
Mbd4 A G 6: 115,849,502 L202S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Psg29 A T 7: 17,210,650 N362Y possibly damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rad51ap1 T C 6: 126,934,768 T78A possibly damaging Het
Rb1 C A 14: 73,199,198 R190L probably damaging Het
Slc34a2 T C 5: 53,069,182 L549P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
St3gal2 A G 8: 110,967,502 N207D probably benign Het
Stat1 T G 1: 52,137,416 D257E possibly damaging Het
Thbs1 A G 2: 118,122,980 D14G noncoding transcript Het
Tkt A G 14: 30,568,274 T287A probably benign Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in 0610040J01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:0610040J01Rik APN 5 63898383 missense possibly damaging 0.60
IGL02229:0610040J01Rik APN 5 63898353 missense possibly damaging 0.51
IGL02389:0610040J01Rik APN 5 63896483 missense probably benign 0.20
IGL02411:0610040J01Rik APN 5 63898116 missense probably benign 0.00
R0243:0610040J01Rik UTSW 5 63898463 missense probably benign 0.09
R0411:0610040J01Rik UTSW 5 63896491 splice donor site probably benign
R1978:0610040J01Rik UTSW 5 63898537 nonsense probably null
R2072:0610040J01Rik UTSW 5 63898737 missense possibly damaging 0.79
R2202:0610040J01Rik UTSW 5 63898668 missense possibly damaging 0.89
R3160:0610040J01Rik UTSW 5 63896490 splice donor site probably benign
R3161:0610040J01Rik UTSW 5 63896490 splice donor site probably benign
R3162:0610040J01Rik UTSW 5 63896490 splice site probably benign
R4428:0610040J01Rik UTSW 5 63898839 missense unknown
R4429:0610040J01Rik UTSW 5 63898839 missense unknown
R4430:0610040J01Rik UTSW 5 63898839 missense unknown
R4431:0610040J01Rik UTSW 5 63898839 missense unknown
R4465:0610040J01Rik UTSW 5 63898839 missense unknown
R4467:0610040J01Rik UTSW 5 63898839 missense unknown
R4491:0610040J01Rik UTSW 5 63898469 missense probably damaging 1.00
R5161:0610040J01Rik UTSW 5 63898001 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCTGGGACTCACTGAATG -3'
(R):5'- TGCCCTATACAGCAAGCAGC -3'

Sequencing Primer
(F):5'- TCACTGAATGAGGCAGGGACC -3'
(R):5'- GAGTAGGCACATGCTTCTA -3'
Posted OnJul 21, 2015