Incidental Mutation 'R4464:St3gal2'
ID330273
Institutional Source Beutler Lab
Gene Symbol St3gal2
Ensembl Gene ENSMUSG00000031749
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 2
SynonymsST3GalII, Siat5
MMRRC Submission 041722-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4464 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location110919922-110972480 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110967502 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 207 (N207D)
Ref Sequence ENSEMBL: ENSMUSP00000113900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034197] [ENSMUST00000117534]
Predicted Effect probably benign
Transcript: ENSMUST00000034197
AA Change: N207D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034197
Gene: ENSMUSG00000031749
AA Change: N207D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_29 94 349 3.8e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117534
AA Change: N207D

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113900
Gene: ENSMUSG00000031749
AA Change: N207D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_29 90 296 7.2e-82 PFAM
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi but can be proteolytically processed to a soluble form. This protein, which is a member of glycosyltransferase family 29, can use the same acceptor substrates as does sialyltransferase 4A. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene apparently display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc3 A G 11: 94,358,786 V1111A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Aldh8a1 C A 10: 21,388,941 probably benign Het
Alms1 A G 6: 85,620,021 T1079A possibly damaging Het
Armc3 T C 2: 19,248,659 Y204H probably damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cst12 G A 2: 148,789,517 V53I possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dennd1a A T 2: 38,243,390 probably benign Het
Fam213a T A 14: 40,997,875 K127N probably damaging Het
Gm7535 C A 17: 17,911,662 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ifngr1 G A 10: 19,597,517 V72I possibly damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Krt86 G A 15: 101,473,914 D122N probably damaging Het
Lrrcc1 A G 3: 14,557,318 K694E probably damaging Het
Mbd4 A G 6: 115,849,502 L155S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Psg29 A T 7: 17,210,650 N362Y possibly damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rad51ap1 T C 6: 126,934,768 N52S possibly damaging Het
Rb1 C A 14: 73,199,198 probably null Het
Slc34a2 T C 5: 53,069,182 L490P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Stat1 T G 1: 52,137,416 D257E possibly damaging Het
Tkt A G 14: 30,568,274 T165A possibly damaging Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in St3gal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:St3gal2 APN 8 110969581 missense probably damaging 1.00
IGL02004:St3gal2 APN 8 110970172 missense probably damaging 1.00
IGL02270:St3gal2 APN 8 110957766 missense probably benign
R0546:St3gal2 UTSW 8 110970106 unclassified probably null
R3695:St3gal2 UTSW 8 110962341 missense probably damaging 1.00
R4297:St3gal2 UTSW 8 110962359 missense probably benign 0.00
R4298:St3gal2 UTSW 8 110962359 missense probably benign 0.00
R4299:St3gal2 UTSW 8 110962359 missense probably benign 0.00
R4691:St3gal2 UTSW 8 110957785 missense probably benign 0.13
R4831:St3gal2 UTSW 8 110957848 missense probably benign 0.17
R5072:St3gal2 UTSW 8 110957718 missense possibly damaging 0.95
R5992:St3gal2 UTSW 8 110969553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGAGTGCCAAATTATCCTG -3'
(R):5'- GGGAAGTGACATAGAATCAACTCC -3'

Sequencing Primer
(F):5'- GAGTGCCAAATTATCCTGTAAAACC -3'
(R):5'- AGAATCAACTCCATTTTTGAGCTCC -3'
Posted On2015-07-21