Incidental Mutation 'R4464:Aldh8a1'
ID330276
Institutional Source Beutler Lab
Gene Symbol Aldh8a1
Ensembl Gene ENSMUSG00000037542
Gene Namealdehyde dehydrogenase 8 family, member A1
SynonymsRALDH4
MMRRC Submission 041722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4464 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location21377291-21396585 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 21388941 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042699]
Predicted Effect probably benign
Transcript: ENSMUST00000042699
SMART Domains Protein: ENSMUSP00000038878
Gene: ENSMUSG00000037542

DomainStartEndE-ValueType
Pfam:Aldedh 19 483 8.6e-170 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159163
SMART Domains Protein: ENSMUSP00000124448
Gene: ENSMUSG00000037542

DomainStartEndE-ValueType
Pfam:Aldedh 16 205 1.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161285
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenases family of proteins. It plays a role in a pathway of 9-cis-retinoic acid biosynthesis in vivo. This enzyme converts 9-cis-retinal into the retinoid X receptor ligand 9-cis-retinoic acid, and has approximately 40-fold higher activity with 9-cis-retinal than with all-trans-retinal. Therefore, it is the first known aldehyde dehydrogenase to show a preference for 9-cis-retinal relative to all-trans-retinal. Three transcript variants encoding distinct protein isoforms have been identified for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc3 A G 11: 94,358,786 V1111A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Alms1 A G 6: 85,620,021 T1079A possibly damaging Het
Armc3 T C 2: 19,248,659 Y204H probably damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cst12 G A 2: 148,789,517 V53I possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dennd1a A T 2: 38,243,390 probably benign Het
Fam213a T A 14: 40,997,875 K127N probably damaging Het
Gm7535 C A 17: 17,911,662 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ifngr1 G A 10: 19,597,517 V72I possibly damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Krt86 G A 15: 101,473,914 D122N probably damaging Het
Lrrcc1 A G 3: 14,557,318 K694E probably damaging Het
Mbd4 A G 6: 115,849,502 L155S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Psg29 A T 7: 17,210,650 N362Y possibly damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rad51ap1 T C 6: 126,934,768 N52S possibly damaging Het
Rb1 C A 14: 73,199,198 probably null Het
Slc34a2 T C 5: 53,069,182 L490P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
St3gal2 A G 8: 110,967,502 N207D probably benign Het
Stat1 T G 1: 52,137,416 D257E possibly damaging Het
Tkt A G 14: 30,568,274 T165A possibly damaging Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in Aldh8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Aldh8a1 APN 10 21395430 missense probably damaging 0.98
IGL01095:Aldh8a1 APN 10 21389281 missense probably benign 0.18
IGL01525:Aldh8a1 APN 10 21391573 missense probably damaging 0.98
IGL02206:Aldh8a1 APN 10 21395575 missense probably benign 0.00
IGL02232:Aldh8a1 APN 10 21395646 missense probably damaging 1.00
IGL03213:Aldh8a1 APN 10 21384717 missense probably damaging 0.97
R0105:Aldh8a1 UTSW 10 21395539 missense probably damaging 0.99
R0105:Aldh8a1 UTSW 10 21395539 missense probably damaging 0.99
R0893:Aldh8a1 UTSW 10 21391694 missense probably benign 0.19
R1168:Aldh8a1 UTSW 10 21384631 splice site probably null
R1764:Aldh8a1 UTSW 10 21395493 missense probably benign 0.01
R4016:Aldh8a1 UTSW 10 21395571 missense probably benign 0.00
R4915:Aldh8a1 UTSW 10 21395763 missense probably damaging 1.00
R5816:Aldh8a1 UTSW 10 21395430 missense probably damaging 0.98
R6032:Aldh8a1 UTSW 10 21389071 missense probably benign 0.29
R6032:Aldh8a1 UTSW 10 21389071 missense probably benign 0.29
R6581:Aldh8a1 UTSW 10 21380842 missense probably damaging 1.00
X0011:Aldh8a1 UTSW 10 21389239 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTATCAAGTTGGAGCCAGTC -3'
(R):5'- GCCCTGTTCCAAACACAATG -3'

Sequencing Primer
(F):5'- CTACATGAGGTTTGATCTGCCCAATG -3'
(R):5'- AACACAATGTTGATCACACCTGGTG -3'
Posted On2015-07-21