Incidental Mutation 'R4465:Map3k6'
ID330298
Institutional Source Beutler Lab
Gene Symbol Map3k6
Ensembl Gene ENSMUSG00000028862
Gene Namemitogen-activated protein kinase kinase kinase 6
SynonymsAsk2, MAPKKK6, MEKK6
MMRRC Submission 041580-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R4465 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location133240818-133252929 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133246333 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 445 (Y445C)
Ref Sequence ENSEMBL: ENSMUSP00000030677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030677]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030677
AA Change: Y445C

PolyPhen 2 Score 0.661 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862
AA Change: Y445C

DomainStartEndE-ValueType
low complexity region 98 109 N/A INTRINSIC
Pfam:DUF4071 130 508 2.3e-150 PFAM
S_TKc 649 907 3.49e-87 SMART
low complexity region 925 940 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
low complexity region 975 990 N/A INTRINSIC
low complexity region 1130 1146 N/A INTRINSIC
coiled coil region 1164 1195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134895
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous and heterozygous null mice display an increased incidence of chemically induced skin tumors and homozygous mice also show resistance to induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Acsbg2 A G 17: 56,861,580 Y180H probably damaging Het
Adgrb3 G T 1: 25,094,366 T1213K probably damaging Het
Atrn A G 2: 130,960,468 T510A probably benign Het
Clasp1 C A 1: 118,561,078 T857N probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col12a1 C A 9: 79,672,910 V1562F possibly damaging Het
Cyp4f40 T A 17: 32,671,212 D285E probably benign Het
Dis3 G A 14: 99,084,114 S599L possibly damaging Het
Dnah11 T C 12: 117,987,451 T3041A probably benign Het
Erbin T C 13: 103,844,885 N511D probably benign Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Gm11541 A T 11: 94,704,222 C7S unknown Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lao1 C A 4: 118,965,307 S141R probably benign Het
Lrrk2 A G 15: 91,747,820 K1316E probably damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Ndnf T A 6: 65,704,196 D486E probably benign Het
Olfr1084 A T 2: 86,639,134 N191K probably benign Het
Olfr1097 A T 2: 86,891,150 N8K probably benign Het
Olfr441 T C 6: 43,115,918 Y59H probably damaging Het
Rab19 T C 6: 39,388,126 S107P probably damaging Het
Slc22a29 A T 19: 8,162,724 L439* probably null Het
Slc5a1 A G 5: 33,146,516 E225G possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Snx25 A G 8: 46,068,229 S373P possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Homo
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Zdhhc22 G A 12: 86,988,223 L152F probably benign Het
Zfpm2 T G 15: 41,096,161 M80R probably benign Het
Other mutations in Map3k6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Map3k6 APN 4 133243044 splice site probably benign
IGL01060:Map3k6 APN 4 133247302 splice site probably null
IGL01116:Map3k6 APN 4 133247128 missense probably damaging 0.98
IGL01341:Map3k6 APN 4 133248060 missense possibly damaging 0.67
IGL02383:Map3k6 APN 4 133246621 splice site probably null
IGL03090:Map3k6 APN 4 133243366 missense probably benign 0.05
IGL03096:Map3k6 APN 4 133251345 nonsense probably null
IGL03149:Map3k6 APN 4 133249688 missense probably damaging 1.00
R0110:Map3k6 UTSW 4 133243794 missense probably damaging 1.00
R0142:Map3k6 UTSW 4 133250946 missense probably benign
R0189:Map3k6 UTSW 4 133246941 missense possibly damaging 0.46
R0368:Map3k6 UTSW 4 133252659 missense probably benign 0.23
R0417:Map3k6 UTSW 4 133248082 nonsense probably null
R0595:Map3k6 UTSW 4 133241263 missense probably damaging 0.98
R0597:Map3k6 UTSW 4 133245552 missense possibly damaging 0.46
R0699:Map3k6 UTSW 4 133248126 missense probably damaging 1.00
R1099:Map3k6 UTSW 4 133247128 missense probably damaging 1.00
R1113:Map3k6 UTSW 4 133245815 missense probably damaging 1.00
R1308:Map3k6 UTSW 4 133245815 missense probably damaging 1.00
R1607:Map3k6 UTSW 4 133252473 missense probably damaging 1.00
R2217:Map3k6 UTSW 4 133246672 missense possibly damaging 0.46
R3734:Map3k6 UTSW 4 133248396 missense possibly damaging 0.79
R3735:Map3k6 UTSW 4 133246372 missense probably benign 0.21
R3743:Map3k6 UTSW 4 133245073 missense probably benign 0.26
R4244:Map3k6 UTSW 4 133251947 missense possibly damaging 0.65
R4245:Map3k6 UTSW 4 133251947 missense possibly damaging 0.65
R4482:Map3k6 UTSW 4 133243399 missense probably benign 0.00
R4827:Map3k6 UTSW 4 133248849 missense possibly damaging 0.92
R5092:Map3k6 UTSW 4 133251743 missense probably benign 0.00
R5110:Map3k6 UTSW 4 133247548 intron probably benign
R5258:Map3k6 UTSW 4 133247642 missense possibly damaging 0.81
R5369:Map3k6 UTSW 4 133247681 missense probably damaging 0.99
R5642:Map3k6 UTSW 4 133245544 missense probably damaging 0.99
R5648:Map3k6 UTSW 4 133243335 missense probably benign 0.25
R6102:Map3k6 UTSW 4 133247131 critical splice donor site probably null
R6144:Map3k6 UTSW 4 133245675 missense probably damaging 1.00
R6476:Map3k6 UTSW 4 133250086 missense probably damaging 0.98
R6511:Map3k6 UTSW 4 133248078 missense probably damaging 0.98
R6522:Map3k6 UTSW 4 133250024 missense possibly damaging 0.65
R6706:Map3k6 UTSW 4 133250939 nonsense probably null
R6874:Map3k6 UTSW 4 133250656 missense probably benign 0.02
Z1088:Map3k6 UTSW 4 133245066 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATATCCATGCTCCTGTGCGTG -3'
(R):5'- GGATACGGGCATCACATACC -3'

Sequencing Primer
(F):5'- TGAGGGCCACAGTGGGAC -3'
(R):5'- GGCACTGTCTATCTATCGTAGTGAC -3'
Posted On2015-07-21