Incidental Mutation 'R4465:0610040J01Rik'
List |< first << previous [record 76 of 386652] next >> last >|
ID330300
Institutional Source Beutler Lab
Gene Symbol 0610040J01Rik
Ensembl Gene ENSMUSG00000060512
Gene NameRIKEN cDNA 0610040J01 gene
Synonyms
MMRRC Submission 041580-MU
Accession Numbers
Stock #R4465 (G1)
Quality Score137
Status Not validated
Chromosome5
Chromosomal Location63812495-63899619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63898839 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 306 (G306V)
Ref Sequence ENSEMBL: ENSMUSP00000080443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081747]
Predicted Effect unknown
Transcript: ENSMUST00000081747
AA Change: G306V
SMART Domains Protein: ENSMUSP00000080443
Gene: ENSMUSG00000060512
AA Change: G306V

DomainStartEndE-ValueType
Pfam:DUF4699 9 313 2.5e-123 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,861,580 Y180H probably damaging Het
Actg1 G A 11: 120,348,032 A46V noncoding transcript Het
Adgrb3 G T 1: 25,094,366 T1213K probably damaging Het
Aldh18a1 G A 19: 40,557,667 Q665* probably null Het
Atrn A G 2: 130,960,468 T510A probably benign Het
Clasp1 C A 1: 118,561,078 T1139N probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col12a1 C A 9: 79,672,910 V1562F possibly damaging Het
Cyp4f40 T A 17: 32,671,212 D285E probably benign Het
Dis3 G A 14: 99,084,114 S599L possibly damaging Het
Dnah11 T C 12: 117,987,451 T3041A probably benign Het
Eps15 G A 4: 109,366,530 V414I unknown Het
Erbb2ip T C 13: 103,844,885 N511D probably benign Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Gm11541 A T 11: 94,704,222 C7S unknown Het
Gsdmcl1 T C 15: 63,849,764 L188P noncoding transcript Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lao1 C A 4: 118,965,307 S141R probably benign Het
Lrrk2 A G 15: 91,747,820 K1316E probably damaging Het
Map3k6 A G 4: 133,246,333 Y445C possibly damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Ndnf T A 6: 65,704,196 D486E probably benign Het
Olfr1084 A T 2: 86,639,134 N191K probably benign Het
Olfr1097 A T 2: 86,891,150 N8K probably benign Het
Olfr441 T C 6: 43,115,918 Y59H probably damaging Het
Rab19 T C 6: 39,388,126 S107P probably damaging Het
Sdc2 T A 15: 32,921,238 L113Q noncoding transcript Het
Slc22a29 A T 19: 8,162,724 L439* probably null Het
Slc5a1 A G 5: 33,146,516 E225G possibly damaging Het
Slc7a11 C T 3: 50,435,416 W269* probably null Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Snx25 A G 8: 46,068,229 S373P possibly damaging Het
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Zdhhc22 G A 12: 86,988,223 L152F probably benign Het
Zfpm2 T G 15: 41,096,161 M212R probably benign Het
Other mutations in 0610040J01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:0610040J01Rik APN 5 63898383 missense possibly damaging 0.60
IGL02229:0610040J01Rik APN 5 63898353 missense possibly damaging 0.51
IGL02389:0610040J01Rik APN 5 63896483 missense probably benign 0.20
IGL02411:0610040J01Rik APN 5 63898116 missense probably benign 0.00
R0243:0610040J01Rik UTSW 5 63898463 missense probably benign 0.09
R0411:0610040J01Rik UTSW 5 63896491 splice donor site probably benign
R1978:0610040J01Rik UTSW 5 63898537 nonsense probably null
R2072:0610040J01Rik UTSW 5 63898737 missense possibly damaging 0.79
R2202:0610040J01Rik UTSW 5 63898668 missense possibly damaging 0.89
R3161:0610040J01Rik UTSW 5 63896490 splice site probably benign
R3162:0610040J01Rik UTSW 5 63896490 splice site probably benign
R4428:0610040J01Rik UTSW 5 63898839 missense unknown
R4429:0610040J01Rik UTSW 5 63898839 missense unknown
R4430:0610040J01Rik UTSW 5 63898839 missense unknown
R4431:0610040J01Rik UTSW 5 63898839 missense unknown
R4464:0610040J01Rik UTSW 5 63898839 missense unknown
R4467:0610040J01Rik UTSW 5 63898839 missense unknown
R4491:0610040J01Rik UTSW 5 63898469 missense probably damaging 1.00
R5161:0610040J01Rik UTSW 5 63898001 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAAGCTGGGACTCACTGAATG -3'
(R):5'- TGCCCTATACAGCAAGCAGC -3'

Sequencing Primer
(F):5'- TCACTGAATGAGGCAGGGACC -3'
(R):5'- GAGTAGGCACATGCTTCTA -3'
Posted OnJul 21, 2015