Incidental Mutation 'R4465:Olfr441'
ID330302
Institutional Source Beutler Lab
Gene Symbol Olfr441
Ensembl Gene ENSMUSG00000094669
Gene Nameolfactory receptor 441
SynonymsMOR261-3, GA_x6K02T2P3E9-4442577-4441645
MMRRC Submission 041580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4465 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location43106369-43117803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43115918 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 59 (Y59H)
Ref Sequence ENSEMBL: ENSMUSP00000150572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095954] [ENSMUST00000204092] [ENSMUST00000213649]
Predicted Effect probably damaging
Transcript: ENSMUST00000095954
AA Change: Y59H

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093648
Gene: ENSMUSG00000094669
AA Change: Y59H

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8.6e-60 PFAM
Pfam:7tm_1 40 289 3.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204092
AA Change: Y59H
SMART Domains Protein: ENSMUSP00000144691
Gene: ENSMUSG00000073110
AA Change: Y59H

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8.6e-60 PFAM
Pfam:7tm_1 40 289 3.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213649
AA Change: Y59H

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Acsbg2 A G 17: 56,861,580 Y180H probably damaging Het
Adgrb3 G T 1: 25,094,366 T1213K probably damaging Het
Atrn A G 2: 130,960,468 T510A probably benign Het
Clasp1 C A 1: 118,561,078 T857N probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col12a1 C A 9: 79,672,910 V1562F possibly damaging Het
Cyp4f40 T A 17: 32,671,212 D285E probably benign Het
Dis3 G A 14: 99,084,114 S599L possibly damaging Het
Dnah11 T C 12: 117,987,451 T3041A probably benign Het
Erbin T C 13: 103,844,885 N511D probably benign Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Gm11541 A T 11: 94,704,222 C7S unknown Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lao1 C A 4: 118,965,307 S141R probably benign Het
Lrrk2 A G 15: 91,747,820 K1316E probably damaging Het
Map3k6 A G 4: 133,246,333 Y445C possibly damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Ndnf T A 6: 65,704,196 D486E probably benign Het
Olfr1084 A T 2: 86,639,134 N191K probably benign Het
Olfr1097 A T 2: 86,891,150 N8K probably benign Het
Rab19 T C 6: 39,388,126 S107P probably damaging Het
Slc22a29 A T 19: 8,162,724 L439* probably null Het
Slc5a1 A G 5: 33,146,516 E225G possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Snx25 A G 8: 46,068,229 S373P possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Homo
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Zdhhc22 G A 12: 86,988,223 L152F probably benign Het
Zfpm2 T G 15: 41,096,161 M80R probably benign Het
Other mutations in Olfr441
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0470:Olfr441 UTSW 6 43116624 missense probably null 0.04
R0528:Olfr441 UTSW 6 43116216 missense possibly damaging 0.56
R1441:Olfr441 UTSW 6 43115946 missense probably benign 0.02
R2048:Olfr441 UTSW 6 43116378 missense probably benign 0.00
R2191:Olfr441 UTSW 6 43116065 missense probably benign 0.13
R4438:Olfr441 UTSW 6 43116287 missense probably benign 0.09
R5191:Olfr441 UTSW 6 43115866 missense probably damaging 1.00
R6353:Olfr441 UTSW 6 43116136 nonsense probably null
R6719:Olfr441 UTSW 6 43115973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCAATCAGACATGGATC -3'
(R):5'- TCCAGCTCATGATGACAGTGTAG -3'

Sequencing Primer
(F):5'- GACATGGATCACAGAGGTCACTC -3'
(R):5'- CAGCTCATGATGACAGTGTAGTGAAG -3'
Posted On2015-07-21