Incidental Mutation 'R4465:Ndnf'
ID330303
Institutional Source Beutler Lab
Gene Symbol Ndnf
Ensembl Gene ENSMUSG00000049001
Gene Nameneuron-derived neurotrophic factor
SynonymsA930038C07Rik, epidermacan
MMRRC Submission 041580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R4465 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location65671590-65712326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65704196 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 486 (D486E)
Ref Sequence ENSEMBL: ENSMUSP00000051297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054351]
Predicted Effect probably benign
Transcript: ENSMUST00000054351
AA Change: D486E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051297
Gene: ENSMUSG00000049001
AA Change: D486E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:FN3 71 161 2e-33 BLAST
FN3 174 324 5.75e-2 SMART
FN3 445 554 1.62e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169795
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Acsbg2 A G 17: 56,861,580 Y180H probably damaging Het
Adgrb3 G T 1: 25,094,366 T1213K probably damaging Het
Atrn A G 2: 130,960,468 T510A probably benign Het
Clasp1 C A 1: 118,561,078 T857N probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col12a1 C A 9: 79,672,910 V1562F possibly damaging Het
Cyp4f40 T A 17: 32,671,212 D285E probably benign Het
Dis3 G A 14: 99,084,114 S599L possibly damaging Het
Dnah11 T C 12: 117,987,451 T3041A probably benign Het
Erbin T C 13: 103,844,885 N511D probably benign Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Gm11541 A T 11: 94,704,222 C7S unknown Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lao1 C A 4: 118,965,307 S141R probably benign Het
Lrrk2 A G 15: 91,747,820 K1316E probably damaging Het
Map3k6 A G 4: 133,246,333 Y445C possibly damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Olfr1084 A T 2: 86,639,134 N191K probably benign Het
Olfr1097 A T 2: 86,891,150 N8K probably benign Het
Olfr441 T C 6: 43,115,918 Y59H probably damaging Het
Rab19 T C 6: 39,388,126 S107P probably damaging Het
Slc22a29 A T 19: 8,162,724 L439* probably null Het
Slc5a1 A G 5: 33,146,516 E225G possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Snx25 A G 8: 46,068,229 S373P possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Homo
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Zdhhc22 G A 12: 86,988,223 L152F probably benign Het
Zfpm2 T G 15: 41,096,161 M80R probably benign Het
Other mutations in Ndnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Ndnf APN 6 65703258 missense probably damaging 1.00
IGL01737:Ndnf APN 6 65703555 missense probably benign 0.15
IGL03000:Ndnf APN 6 65703315 missense possibly damaging 0.95
IGL03236:Ndnf APN 6 65696172 missense possibly damaging 0.74
IGL03373:Ndnf APN 6 65704288 missense possibly damaging 0.47
K3955:Ndnf UTSW 6 65701429 splice site probably benign
R1457:Ndnf UTSW 6 65704014 missense possibly damaging 0.82
R1670:Ndnf UTSW 6 65703070 missense probably benign 0.00
R1687:Ndnf UTSW 6 65703423 missense probably benign 0.00
R1909:Ndnf UTSW 6 65703313 missense possibly damaging 0.94
R3951:Ndnf UTSW 6 65703141 missense possibly damaging 0.79
R4043:Ndnf UTSW 6 65703936 missense possibly damaging 0.89
R4983:Ndnf UTSW 6 65703571 missense possibly damaging 0.89
R5271:Ndnf UTSW 6 65703666 missense possibly damaging 0.52
R6785:Ndnf UTSW 6 65703063 missense probably benign 0.01
X0066:Ndnf UTSW 6 65701517 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCTCATTCGACTGAAAGGC -3'
(R):5'- TGTCCTACGACGTAAACATCC -3'

Sequencing Primer
(F):5'- CTCATTCGACTGAAAGGCAACAGG -3'
(R):5'- CAGCAGGTAAGACTTCCCAGG -3'
Posted On2015-07-21