Incidental Mutation 'R4465:Klk12'
ID330305
Institutional Source Beutler Lab
Gene Symbol Klk12
Ensembl Gene ENSMUSG00000044430
Gene Namekallikrein related-peptidase 12
SynonymsKLK-L5, 2310008B01Rik
MMRRC Submission 041580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R4465 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43768897-43773585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43773383 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 245 (R245W)
Ref Sequence ENSEMBL: ENSMUSP00000103604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014063] [ENSMUST00000080211] [ENSMUST00000107970] [ENSMUST00000171458]
Predicted Effect probably damaging
Transcript: ENSMUST00000014063
AA Change: R245W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000014063
Gene: ENSMUSG00000044430
AA Change: R245W

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 21 240 1.3e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080211
SMART Domains Protein: ENSMUSP00000079101
Gene: ENSMUSG00000067616

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
Tryp_SPc 47 269 5.14e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107970
AA Change: R245W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103604
Gene: ENSMUSG00000044430
AA Change: R245W

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 21 240 1.3e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171458
SMART Domains Protein: ENSMUSP00000132721
Gene: ENSMUSG00000067616

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 20 242 5.14e-95 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206165
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Acsbg2 A G 17: 56,861,580 Y180H probably damaging Het
Adgrb3 G T 1: 25,094,366 T1213K probably damaging Het
Atrn A G 2: 130,960,468 T510A probably benign Het
Clasp1 C A 1: 118,561,078 T857N probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col12a1 C A 9: 79,672,910 V1562F possibly damaging Het
Cyp4f40 T A 17: 32,671,212 D285E probably benign Het
Dis3 G A 14: 99,084,114 S599L possibly damaging Het
Dnah11 T C 12: 117,987,451 T3041A probably benign Het
Erbin T C 13: 103,844,885 N511D probably benign Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Gm11541 A T 11: 94,704,222 C7S unknown Het
Lao1 C A 4: 118,965,307 S141R probably benign Het
Lrrk2 A G 15: 91,747,820 K1316E probably damaging Het
Map3k6 A G 4: 133,246,333 Y445C possibly damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Ndnf T A 6: 65,704,196 D486E probably benign Het
Olfr1084 A T 2: 86,639,134 N191K probably benign Het
Olfr1097 A T 2: 86,891,150 N8K probably benign Het
Olfr441 T C 6: 43,115,918 Y59H probably damaging Het
Rab19 T C 6: 39,388,126 S107P probably damaging Het
Slc22a29 A T 19: 8,162,724 L439* probably null Het
Slc5a1 A G 5: 33,146,516 E225G possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Snx25 A G 8: 46,068,229 S373P possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Homo
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Zdhhc22 G A 12: 86,988,223 L152F probably benign Het
Zfpm2 T G 15: 41,096,161 M80R probably benign Het
Other mutations in Klk12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Klk12 APN 7 43769689 missense probably benign 0.18
R4467:Klk12 UTSW 7 43773383 missense probably damaging 1.00
R4575:Klk12 UTSW 7 43773243 missense probably damaging 1.00
R4576:Klk12 UTSW 7 43773243 missense probably damaging 1.00
R4577:Klk12 UTSW 7 43773243 missense probably damaging 1.00
R4578:Klk12 UTSW 7 43773243 missense probably damaging 1.00
R5480:Klk12 UTSW 7 43771058 missense probably benign 0.03
R6834:Klk12 UTSW 7 43773348 missense possibly damaging 0.59
X0064:Klk12 UTSW 7 43770918 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTAGCATGTTCTCCCGGTG -3'
(R):5'- AGTTGTACAGCTGCCTCTCC -3'

Sequencing Primer
(F):5'- GCTTGGAGCCACTTTCTTTAAG -3'
(R):5'- CGCTGCCATGGGTGTAGTC -3'
Posted On2015-07-21