Incidental Mutation 'R4465:Snx25'
ID330307
Institutional Source Beutler Lab
Gene Symbol Snx25
Ensembl Gene ENSMUSG00000038291
Gene Namesorting nexin 25
SynonymsLOC382008, SBBI31
MMRRC Submission 041580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R4465 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location46033261-46152159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46068229 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 373 (S373P)
Ref Sequence ENSEMBL: ENSMUSP00000106007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041582] [ENSMUST00000110377] [ENSMUST00000110378] [ENSMUST00000170416]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041582
AA Change: S227P

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035785
Gene: ENSMUSG00000038291
AA Change: S227P

DomainStartEndE-ValueType
Pfam:PXA 1 163 9e-32 PFAM
RGS 287 401 6.62e-10 SMART
low complexity region 421 438 N/A INTRINSIC
PX 512 624 1.38e-10 SMART
low complexity region 658 663 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Nexin_C 701 808 1.7e-35 PFAM
low complexity region 812 828 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110377
SMART Domains Protein: ENSMUSP00000106006
Gene: ENSMUSG00000038291

DomainStartEndE-ValueType
Pfam:PXA 1 138 5.8e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110378
AA Change: S373P

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106007
Gene: ENSMUSG00000038291
AA Change: S373P

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Pfam:PXA 145 306 8.7e-30 PFAM
RGS 433 547 6.62e-10 SMART
low complexity region 567 584 N/A INTRINSIC
PX 658 770 1.38e-10 SMART
low complexity region 804 809 N/A INTRINSIC
low complexity region 810 822 N/A INTRINSIC
Pfam:Nexin_C 847 953 1e-28 PFAM
low complexity region 958 974 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000144244
AA Change: S46P
Predicted Effect possibly damaging
Transcript: ENSMUST00000170416
AA Change: S227P

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127640
Gene: ENSMUSG00000038291
AA Change: S227P

DomainStartEndE-ValueType
Pfam:PXA 1 163 9e-32 PFAM
RGS 287 401 6.62e-10 SMART
low complexity region 421 438 N/A INTRINSIC
PX 512 624 1.38e-10 SMART
low complexity region 658 663 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Nexin_C 701 808 1.7e-35 PFAM
low complexity region 812 828 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176410
Predicted Effect probably benign
Transcript: ENSMUST00000177186
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Acsbg2 A G 17: 56,861,580 Y180H probably damaging Het
Adgrb3 G T 1: 25,094,366 T1213K probably damaging Het
Atrn A G 2: 130,960,468 T510A probably benign Het
Clasp1 C A 1: 118,561,078 T857N probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col12a1 C A 9: 79,672,910 V1562F possibly damaging Het
Cyp4f40 T A 17: 32,671,212 D285E probably benign Het
Dis3 G A 14: 99,084,114 S599L possibly damaging Het
Dnah11 T C 12: 117,987,451 T3041A probably benign Het
Erbin T C 13: 103,844,885 N511D probably benign Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Gm11541 A T 11: 94,704,222 C7S unknown Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lao1 C A 4: 118,965,307 S141R probably benign Het
Lrrk2 A G 15: 91,747,820 K1316E probably damaging Het
Map3k6 A G 4: 133,246,333 Y445C possibly damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Ndnf T A 6: 65,704,196 D486E probably benign Het
Olfr1084 A T 2: 86,639,134 N191K probably benign Het
Olfr1097 A T 2: 86,891,150 N8K probably benign Het
Olfr441 T C 6: 43,115,918 Y59H probably damaging Het
Rab19 T C 6: 39,388,126 S107P probably damaging Het
Slc22a29 A T 19: 8,162,724 L439* probably null Het
Slc5a1 A G 5: 33,146,516 E225G possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Homo
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Zdhhc22 G A 12: 86,988,223 L152F probably benign Het
Zfpm2 T G 15: 41,096,161 M80R probably benign Het
Other mutations in Snx25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Snx25 APN 8 46038476 missense probably damaging 1.00
IGL01432:Snx25 APN 8 46105160 missense probably damaging 0.96
IGL01600:Snx25 APN 8 46116310 missense probably benign 0.00
IGL02150:Snx25 APN 8 46116281 missense possibly damaging 0.89
IGL02386:Snx25 APN 8 46041349 missense possibly damaging 0.93
IGL02691:Snx25 APN 8 46105265 missense possibly damaging 0.88
IGL03338:Snx25 APN 8 46045210 missense probably benign 0.04
IGL03377:Snx25 APN 8 46080301 unclassified probably benign
duo UTSW 8 46124082 start codon destroyed probably null 0.88
R0047:Snx25 UTSW 8 46041365 missense probably damaging 0.99
R0047:Snx25 UTSW 8 46041365 missense probably damaging 0.99
R0048:Snx25 UTSW 8 46105109 splice site probably benign
R0048:Snx25 UTSW 8 46105109 splice site probably benign
R0056:Snx25 UTSW 8 46038513 missense probably damaging 1.00
R0546:Snx25 UTSW 8 46103630 missense probably benign 0.00
R0791:Snx25 UTSW 8 46124082 start codon destroyed probably null 0.88
R1165:Snx25 UTSW 8 46035715 missense probably damaging 0.99
R1255:Snx25 UTSW 8 46116238 missense probably benign 0.13
R1262:Snx25 UTSW 8 46105291 missense probably damaging 0.98
R1522:Snx25 UTSW 8 46124082 start codon destroyed probably null 0.88
R1652:Snx25 UTSW 8 46049473 missense probably damaging 0.99
R1710:Snx25 UTSW 8 46116207 missense possibly damaging 0.69
R1829:Snx25 UTSW 8 46035632 missense possibly damaging 0.82
R2090:Snx25 UTSW 8 46056113 missense probably damaging 1.00
R2158:Snx25 UTSW 8 46041407 missense probably damaging 1.00
R2906:Snx25 UTSW 8 46049523 intron probably null
R4244:Snx25 UTSW 8 46105254 missense probably damaging 0.98
R4394:Snx25 UTSW 8 46035678 missense probably damaging 1.00
R4586:Snx25 UTSW 8 46116437 intron probably benign
R4663:Snx25 UTSW 8 46035579 missense probably damaging 1.00
R4961:Snx25 UTSW 8 46068192 missense probably damaging 0.99
R5104:Snx25 UTSW 8 46068166 makesense probably null
R5634:Snx25 UTSW 8 46041391 missense possibly damaging 0.94
R6128:Snx25 UTSW 8 46105203 missense probably benign 0.01
R6344:Snx25 UTSW 8 46035638 nonsense probably null
R6382:Snx25 UTSW 8 46055991 missense probably benign
R6523:Snx25 UTSW 8 46055855 missense probably damaging 0.96
R6798:Snx25 UTSW 8 46033773 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTTACCTTTTGGCTCTGAGGC -3'
(R):5'- ACACATGCCTGTAATAATACATGCC -3'

Sequencing Primer
(F):5'- GCTCTGAGGCCCTTCCC -3'
(R):5'- AGGTGCAGGCCTTTAATCAC -3'
Posted On2015-07-21