Incidental Mutation 'R4465:Dis3'
ID330314
Institutional Source Beutler Lab
Gene Symbol Dis3
Ensembl Gene ENSMUSG00000033166
Gene NameDIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease
Synonyms2810028N01Rik
MMRRC Submission 041580-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.974) question?
Stock #R4465 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location99075206-99099770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99084114 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 599 (S599L)
Ref Sequence ENSEMBL: ENSMUSP00000041906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042471] [ENSMUST00000227022] [ENSMUST00000228643]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042471
AA Change: S599L

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041906
Gene: ENSMUSG00000033166
AA Change: S599L

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
PINc 64 182 2.8e-24 SMART
low complexity region 425 436 N/A INTRINSIC
RNB 467 797 5.56e-141 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228449
Predicted Effect probably benign
Transcript: ENSMUST00000228643
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Acsbg2 A G 17: 56,861,580 Y180H probably damaging Het
Adgrb3 G T 1: 25,094,366 T1213K probably damaging Het
Atrn A G 2: 130,960,468 T510A probably benign Het
Clasp1 C A 1: 118,561,078 T857N probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col12a1 C A 9: 79,672,910 V1562F possibly damaging Het
Cyp4f40 T A 17: 32,671,212 D285E probably benign Het
Dnah11 T C 12: 117,987,451 T3041A probably benign Het
Erbin T C 13: 103,844,885 N511D probably benign Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Gm11541 A T 11: 94,704,222 C7S unknown Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lao1 C A 4: 118,965,307 S141R probably benign Het
Lrrk2 A G 15: 91,747,820 K1316E probably damaging Het
Map3k6 A G 4: 133,246,333 Y445C possibly damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Ndnf T A 6: 65,704,196 D486E probably benign Het
Olfr1084 A T 2: 86,639,134 N191K probably benign Het
Olfr1097 A T 2: 86,891,150 N8K probably benign Het
Olfr441 T C 6: 43,115,918 Y59H probably damaging Het
Rab19 T C 6: 39,388,126 S107P probably damaging Het
Slc22a29 A T 19: 8,162,724 L439* probably null Het
Slc5a1 A G 5: 33,146,516 E225G possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Snx25 A G 8: 46,068,229 S373P possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Homo
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Zdhhc22 G A 12: 86,988,223 L152F probably benign Het
Zfpm2 T G 15: 41,096,161 M80R probably benign Het
Other mutations in Dis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Dis3 APN 14 99082674 missense probably damaging 1.00
IGL00821:Dis3 APN 14 99091486 missense probably benign 0.00
IGL00975:Dis3 APN 14 99079234 missense probably damaging 1.00
IGL01536:Dis3 APN 14 99079423 missense probably damaging 1.00
IGL01538:Dis3 APN 14 99097745 missense probably benign 0.00
IGL02143:Dis3 APN 14 99091318 splice site probably benign
IGL02270:Dis3 APN 14 99078354 missense probably benign 0.01
IGL02354:Dis3 APN 14 99079712 nonsense probably null
IGL02361:Dis3 APN 14 99079712 nonsense probably null
IGL02650:Dis3 APN 14 99098785 missense probably benign 0.00
IGL03053:Dis3 APN 14 99098734 missense probably benign 0.00
IGL03057:Dis3 APN 14 99089990 missense possibly damaging 0.95
IGL03389:Dis3 APN 14 99095347 splice site probably benign
R0415:Dis3 UTSW 14 99087456 missense probably damaging 1.00
R0504:Dis3 UTSW 14 99081390 splice site probably benign
R1535:Dis3 UTSW 14 99079426 missense probably damaging 1.00
R1756:Dis3 UTSW 14 99086103 missense probably damaging 1.00
R1767:Dis3 UTSW 14 99084142 missense probably damaging 1.00
R1883:Dis3 UTSW 14 99091469 missense probably benign 0.21
R1938:Dis3 UTSW 14 99097590 missense probably benign 0.09
R2056:Dis3 UTSW 14 99098815 missense possibly damaging 0.90
R2133:Dis3 UTSW 14 99079877 missense probably benign 0.18
R2448:Dis3 UTSW 14 99087412 missense probably damaging 0.99
R3407:Dis3 UTSW 14 99098776 missense probably benign 0.15
R4052:Dis3 UTSW 14 99095316 missense probably benign 0.00
R4207:Dis3 UTSW 14 99095316 missense probably benign 0.00
R4208:Dis3 UTSW 14 99095316 missense probably benign 0.00
R4612:Dis3 UTSW 14 99091435 missense probably benign 0.07
R4859:Dis3 UTSW 14 99087790 missense probably damaging 1.00
R4932:Dis3 UTSW 14 99088904 missense probably damaging 1.00
R5273:Dis3 UTSW 14 99098806 missense probably benign 0.32
R5335:Dis3 UTSW 14 99097653 missense possibly damaging 0.72
R5409:Dis3 UTSW 14 99085932 missense possibly damaging 0.95
R5802:Dis3 UTSW 14 99099664 missense probably damaging 1.00
R6156:Dis3 UTSW 14 99098779 missense probably benign 0.10
R6309:Dis3 UTSW 14 99085922 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTGTTATGGTAAGGCAAATGG -3'
(R):5'- ACCTCTGACCACTGTATGTGTG -3'

Sequencing Primer
(F):5'- GTCTATTACGTAGAGTCTACCAGC -3'
(R):5'- CCACTGTATGTGTGTGGTGGC -3'
Posted On2015-07-21