Incidental Mutation 'R4465:Lrrk2'
ID330318
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Nameleucine-rich repeat kinase 2
Synonyms9330188B09Rik, 4921513O20Rik, LOC381026, cI-46, D630001M17Rik
MMRRC Submission 041580-MU
Accession Numbers

Genbank: NM_025730; MGI: 1913975

Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R4465 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location91673175-91816120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91747820 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1316 (K1316E)
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
Predicted Effect probably damaging
Transcript: ENSMUST00000060642
AA Change: K1316E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: K1316E

DomainStartEndE-ValueType
low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140734
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Acsbg2 A G 17: 56,861,580 Y180H probably damaging Het
Adgrb3 G T 1: 25,094,366 T1213K probably damaging Het
Atrn A G 2: 130,960,468 T510A probably benign Het
Clasp1 C A 1: 118,561,078 T857N probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col12a1 C A 9: 79,672,910 V1562F possibly damaging Het
Cyp4f40 T A 17: 32,671,212 D285E probably benign Het
Dis3 G A 14: 99,084,114 S599L possibly damaging Het
Dnah11 T C 12: 117,987,451 T3041A probably benign Het
Erbin T C 13: 103,844,885 N511D probably benign Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Gm11541 A T 11: 94,704,222 C7S unknown Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lao1 C A 4: 118,965,307 S141R probably benign Het
Map3k6 A G 4: 133,246,333 Y445C possibly damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Ndnf T A 6: 65,704,196 D486E probably benign Het
Olfr1084 A T 2: 86,639,134 N191K probably benign Het
Olfr1097 A T 2: 86,891,150 N8K probably benign Het
Olfr441 T C 6: 43,115,918 Y59H probably damaging Het
Rab19 T C 6: 39,388,126 S107P probably damaging Het
Slc22a29 A T 19: 8,162,724 L439* probably null Het
Slc5a1 A G 5: 33,146,516 E225G possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Snx25 A G 8: 46,068,229 S373P possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Homo
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Zdhhc22 G A 12: 86,988,223 L152F probably benign Het
Zfpm2 T G 15: 41,096,161 M80R probably benign Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91747799 missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91699943 missense probably benign
IGL00770:Lrrk2 APN 15 91801833 splice site probably benign
IGL00774:Lrrk2 APN 15 91801833 splice site probably benign
IGL00791:Lrrk2 APN 15 91779841 missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91755790 missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91757058 missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91738832 missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91726137 missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91683142 missense probably benign
IGL01301:Lrrk2 APN 15 91767339 missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91700569 splice site probably null
IGL01465:Lrrk2 APN 15 91728925 missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91812313 missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91699989 missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91774988 missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91779946 missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91731491 missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91726308 critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91685822 missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91750277 missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91747755 missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91700578 missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91797414 splice site probably null
3-1:Lrrk2 UTSW 15 91801934 missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91767339 missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91673358 missense probably benign
H8786:Lrrk2 UTSW 15 91673358 missense probably benign
IGL02835:Lrrk2 UTSW 15 91814660 critical splice acceptor site probably null
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0078:Lrrk2 UTSW 15 91734009 missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91745796 missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91778414 splice site probably benign
R0448:Lrrk2 UTSW 15 91709305 missense probably damaging 0.99
R0449:Lrrk2 UTSW 15 91750275 missense probably damaging 1.00
R0610:Lrrk2 UTSW 15 91815416 missense probably benign
R0617:Lrrk2 UTSW 15 91752278 missense probably benign 0.00
R0632:Lrrk2 UTSW 15 91796028 missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91772996 missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91757070 critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91775046 splice site probably null
R0766:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91755962 missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91729081 missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91729169 missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91673689 missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91700468 nonsense probably null
R1223:Lrrk2 UTSW 15 91673635 missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91812360 missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91728920 missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R1637:Lrrk2 UTSW 15 91734058 missense probably benign
R1773:Lrrk2 UTSW 15 91779981 missense possibly damaging 0.96
R1809:Lrrk2 UTSW 15 91699892 missense possibly damaging 0.86
R1839:Lrrk2 UTSW 15 91683134 missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91736661 splice site probably null
R2160:Lrrk2 UTSW 15 91796060 missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91764716 missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91797526 splice site probably benign
R2516:Lrrk2 UTSW 15 91755927 missense probably benign
R3110:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91737111 missense probably benign
R3842:Lrrk2 UTSW 15 91755916 missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91747700 missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91747701 missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91767461 critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91712780 missense possibly damaging 0.69
R3938:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3982:Lrrk2 UTSW 15 91709284 missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91815483 missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91755794 missense probably benign 0.19
R4296:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R4478:Lrrk2 UTSW 15 91723188 missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91705120 missense probably benign
R4539:Lrrk2 UTSW 15 91729142 missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91765681 missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91699927 missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91688901 missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91764759 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91712828 missense probably benign
R4945:Lrrk2 UTSW 15 91804920 missense probably benign 0.02
R4948:Lrrk2 UTSW 15 91803389 missense probably benign 0.20
R5000:Lrrk2 UTSW 15 91749878 missense probably damaging 1.00
R5031:Lrrk2 UTSW 15 91700619 missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91765790 missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91796089 missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91814644 intron probably null
R5551:Lrrk2 UTSW 15 91812350 missense probably benign
R5574:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91765745 missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91803301 nonsense probably null
R5712:Lrrk2 UTSW 15 91702222 nonsense probably null
R5728:Lrrk2 UTSW 15 91774974 missense probably benign 0.36
R5782:Lrrk2 UTSW 15 91702183 missense probably damaging 1.00
R5788:Lrrk2 UTSW 15 91764648 missense possibly damaging 0.55
R5821:Lrrk2 UTSW 15 91709390 critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91755949 missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91734046 missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91745831 missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91772945 missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91723135 missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91747826 missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91702247 missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91742266 missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91723218 missense possibly damaging 0.50
X0028:Lrrk2 UTSW 15 91738851 missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91726240 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GTTTCCCTCTCACCAATGGG -3'
(R):5'- GGGCTGCATCTAAACACACC -3'

Sequencing Primer
(F):5'- TGTCTGTTTTATTAAGATTCCTCCAG -3'
(R):5'- CCATTAAATGGGAAGCATGCC -3'
Posted On2015-07-21