Incidental Mutation 'R4472:Adgrb2'
ID330402
Institutional Source Beutler Lab
Gene Symbol Adgrb2
Ensembl Gene ENSMUSG00000028782
Gene Nameadhesion G protein-coupled receptor B2
SynonymsBai2
MMRRC Submission 041729-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4472 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129984870-130022633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130008353 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 509 (A509V)
Ref Sequence ENSEMBL: ENSMUSP00000112869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030571] [ENSMUST00000097868] [ENSMUST00000106015] [ENSMUST00000106017] [ENSMUST00000106018] [ENSMUST00000120204] [ENSMUST00000121049]
Predicted Effect probably benign
Transcript: ENSMUST00000030571
AA Change: A564V

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030571
Gene: ENSMUSG00000028782
AA Change: A564V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:GAIN 600 842 1.6e-41 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1192 1.7e-67 PFAM
low complexity region 1357 1371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097868
AA Change: A564V

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095480
Gene: ENSMUSG00000028782
AA Change: A564V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 1.2e-54 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1159 2.6e-69 PFAM
low complexity region 1324 1338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106012
Predicted Effect probably benign
Transcript: ENSMUST00000106015
AA Change: A564V

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101636
Gene: ENSMUSG00000028782
AA Change: A564V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 6.4e-55 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1192 4.1e-68 PFAM
low complexity region 1357 1371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106017
AA Change: A564V

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101638
Gene: ENSMUSG00000028782
AA Change: A564V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 6.3e-55 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1180 4.6e-68 PFAM
low complexity region 1345 1359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106018
AA Change: A509V

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101639
Gene: ENSMUSG00000028782
AA Change: A509V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 1.86e-13 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 1.1e-54 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1104 2.4e-69 PFAM
low complexity region 1269 1283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120204
AA Change: A509V

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112524
Gene: ENSMUSG00000028782
AA Change: A509V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 8.2e-55 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1104 9.6e-70 PFAM
low complexity region 1269 1283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121049
AA Change: A509V

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112869
Gene: ENSMUSG00000028782
AA Change: A509V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 1.86e-13 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 6.1e-55 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1137 3.8e-68 PFAM
low complexity region 1302 1316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166118
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a a seven-span transmembrane protein that is thought to be a member of the secretin receptor family. The encoded protein is a brain-specific inhibitor of angiogenesis. The mature peptide may be further cleaved into additional products (PMID:20367554). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene show a lessening of depression like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A T 9: 40,050,698 noncoding transcript Het
Accsl T A 2: 93,863,991 probably null Het
Accsl G T 2: 93,863,992 probably null Het
Adcy1 G A 11: 7,130,369 V371M probably damaging Het
Adgrg6 T A 10: 14,436,781 Q754L probably damaging Het
Agap2 T C 10: 127,091,213 I1008T probably damaging Het
Aph1c T G 9: 66,827,769 H150P probably damaging Het
Atcay T C 10: 81,212,527 R242G possibly damaging Het
Atg2a G A 19: 6,258,955 V1724M probably damaging Het
Bbs12 T C 3: 37,319,220 V54A possibly damaging Het
Card14 A G 11: 119,333,958 M604V possibly damaging Het
Cd28 A T 1: 60,763,234 H104L probably benign Het
Cntn5 A T 9: 10,048,771 D262E probably damaging Het
Col6a3 A G 1: 90,822,014 V366A probably benign Het
Csnk1d G A 11: 120,964,974 probably benign Het
Dcaf11 T A 14: 55,565,606 probably benign Het
Dpy19l4 G A 4: 11,304,053 T119M possibly damaging Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Fbrsl1 G A 5: 110,379,066 probably benign Het
Fbxo10 C T 4: 45,043,693 R710H probably damaging Het
Fbxw9 G A 8: 85,060,200 D25N probably damaging Het
Gm14295 C T 2: 176,809,593 T292I possibly damaging Het
Gm4884 C G 7: 41,043,263 Q219E probably benign Het
Gpr150 A G 13: 76,056,154 V224A probably benign Het
Hps1 A T 19: 42,762,496 I355N probably damaging Het
Lmbr1l A G 15: 98,906,297 S374P probably benign Het
Macf1 A T 4: 123,395,989 N5458K probably damaging Het
Man1b1 C G 2: 25,332,855 probably benign Het
Morc3 A G 16: 93,874,757 probably null Het
Mrgpra4 T C 7: 47,981,791 T21A probably benign Het
Myo1a G T 10: 127,710,458 V277L probably benign Het
Nkain4 C G 2: 180,954,622 M1I probably null Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Oas2 A T 5: 120,741,155 D373E possibly damaging Het
Olfr970 T A 9: 39,820,574 *312R probably null Het
Oser1 T A 2: 163,415,580 E11V probably null Het
Oser1 C T 2: 163,415,581 E11K probably damaging Het
Pacsin3 A G 2: 91,262,943 probably null Het
Pcdh20 T C 14: 88,468,998 S289G probably benign Het
Phlpp1 A G 1: 106,386,446 D1183G probably damaging Het
Pign T C 1: 105,648,220 K232E probably benign Het
Polk A G 13: 96,493,905 S383P probably damaging Het
Prom2 C A 2: 127,540,191 R101L probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rnf31 T A 14: 55,603,320 Y1015N probably damaging Het
Spata3 T C 1: 86,026,430 Y305H probably benign Het
Sv2a G A 3: 96,192,494 V587M probably benign Het
Synj1 A G 16: 90,969,181 probably null Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tcaf1 A C 6: 42,679,314 S243A probably benign Het
Tmem9 A G 1: 136,027,496 T123A probably benign Het
Trav4-4-dv10 T C 14: 53,683,730 probably benign Het
Trbv15 G A 6: 41,141,559 R83Q probably damaging Het
Trim27 A G 13: 21,189,886 I268V probably benign Het
Tubgcp6 T A 15: 89,103,654 S1031C probably damaging Het
Vmn1r89 C A 7: 13,219,872 H110Q probably benign Het
Vmn2r30 T C 7: 7,317,092 N545S probably damaging Het
Wls G A 3: 159,897,383 M144I probably benign Het
Yme1l1 T C 2: 23,186,332 probably null Het
Zeb2 A T 2: 45,023,011 L56Q probably damaging Het
Other mutations in Adgrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Adgrb2 APN 4 130018805 missense probably damaging 1.00
IGL00425:Adgrb2 APN 4 130019072 missense probably benign 0.09
IGL00490:Adgrb2 APN 4 130011872 missense possibly damaging 0.82
IGL00928:Adgrb2 APN 4 129992303 missense probably benign
IGL01353:Adgrb2 APN 4 130012300 missense probably damaging 1.00
IGL01521:Adgrb2 APN 4 129992292 missense probably damaging 0.98
IGL01590:Adgrb2 APN 4 130013813 splice site probably benign
IGL01813:Adgrb2 APN 4 130012566 missense probably benign 0.00
IGL01831:Adgrb2 APN 4 130009394 missense probably damaging 1.00
IGL01939:Adgrb2 APN 4 129992132 missense probably damaging 0.99
IGL01960:Adgrb2 APN 4 130012384 splice site probably benign
IGL01993:Adgrb2 APN 4 130018842 missense possibly damaging 0.94
IGL02646:Adgrb2 APN 4 130019282 critical splice donor site probably null
IGL02655:Adgrb2 APN 4 129992179 nonsense probably null
IGL02695:Adgrb2 APN 4 130018832 missense probably damaging 1.00
IGL02998:Adgrb2 APN 4 130019069 missense probably benign 0.15
IGL03372:Adgrb2 APN 4 130017569 missense probably benign 0.42
R0098:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0206:Adgrb2 UTSW 4 129992559 missense probably damaging 1.00
R0311:Adgrb2 UTSW 4 130017129 missense probably damaging 1.00
R0380:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0382:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0492:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0544:Adgrb2 UTSW 4 130017542 missense probably damaging 0.98
R0965:Adgrb2 UTSW 4 129992416 small deletion probably benign
R1458:Adgrb2 UTSW 4 130014591 missense possibly damaging 0.48
R1601:Adgrb2 UTSW 4 129992837 missense probably benign 0.43
R1711:Adgrb2 UTSW 4 129992624 missense probably damaging 1.00
R1758:Adgrb2 UTSW 4 130011875 missense probably damaging 1.00
R1783:Adgrb2 UTSW 4 130009305 missense possibly damaging 0.61
R1827:Adgrb2 UTSW 4 130012557 missense probably damaging 1.00
R1838:Adgrb2 UTSW 4 130010231 missense probably benign 0.00
R1881:Adgrb2 UTSW 4 130010285 missense probably damaging 1.00
R1888:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R1888:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R1894:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R2275:Adgrb2 UTSW 4 130006854 missense probably damaging 1.00
R2926:Adgrb2 UTSW 4 130008344 missense probably damaging 1.00
R4490:Adgrb2 UTSW 4 130012328 missense possibly damaging 0.91
R4499:Adgrb2 UTSW 4 129992661 missense probably damaging 0.99
R4758:Adgrb2 UTSW 4 130009350 missense probably damaging 1.00
R4900:Adgrb2 UTSW 4 130013875 missense probably damaging 1.00
R4904:Adgrb2 UTSW 4 130012539 missense possibly damaging 0.50
R4922:Adgrb2 UTSW 4 130007852 missense probably damaging 1.00
R5330:Adgrb2 UTSW 4 130022202 missense possibly damaging 0.92
R5331:Adgrb2 UTSW 4 130022202 missense possibly damaging 0.92
R5550:Adgrb2 UTSW 4 130014934 critical splice acceptor site probably null
R5995:Adgrb2 UTSW 4 130017103 missense probably damaging 1.00
R6047:Adgrb2 UTSW 4 130018705 missense probably damaging 1.00
R6534:Adgrb2 UTSW 4 130022219 missense probably damaging 0.98
R6565:Adgrb2 UTSW 4 130019276 missense probably damaging 1.00
R6813:Adgrb2 UTSW 4 130009491 missense probably damaging 1.00
R6963:Adgrb2 UTSW 4 130014362 frame shift probably null
R6966:Adgrb2 UTSW 4 130014362 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGCTGGCGAGATCATTTACAAC -3'
(R):5'- CAGTTTATACCAAGGCATGAGGG -3'

Sequencing Primer
(F):5'- GGCGAGATCATTTACAACAAGTGTCC -3'
(R):5'- CATGAGGGAATGAATGAGCCTTAAGC -3'
Posted On2015-07-21