Incidental Mutation 'R4474:Rab22a'
ID330478
Institutional Source Beutler Lab
Gene Symbol Rab22a
Ensembl Gene ENSMUSG00000027519
Gene NameRAB22A, member RAS oncogene family
SynonymsRab22, E130120E14Rik, 3732413A17Rik
MMRRC Submission 041731-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4474 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location173659760-173707343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 173695263 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 85 (T85M)
Ref Sequence ENSEMBL: ENSMUSP00000104738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029024] [ENSMUST00000109110] [ENSMUST00000142820]
Predicted Effect probably damaging
Transcript: ENSMUST00000029024
AA Change: T92M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029024
Gene: ENSMUSG00000027519
AA Change: T92M

DomainStartEndE-ValueType
RAB 6 169 1.96e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109110
AA Change: T85M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104738
Gene: ENSMUSG00000027519
AA Change: T85M

DomainStartEndE-ValueType
Pfam:Arf 1 159 2.7e-8 PFAM
Pfam:Miro 7 114 4.3e-14 PFAM
Pfam:Ras 7 161 2e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000142820
AA Change: R65C

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122799
Gene: ENSMUSG00000027519
AA Change: R65C

DomainStartEndE-ValueType
Pfam:Ras 7 61 1.1e-11 PFAM
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RAB family of small GTPases. The GTP-bound form of the encoded protein has been shown to interact with early-endosomal antigen 1, and may be involved in the trafficking of and interaction between endosomal compartments. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,233,772 I397K possibly damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Cdh23 G T 10: 60,311,086 A2795D probably damaging Het
Cdk19 G A 10: 40,469,956 probably null Het
Cep104 T A 4: 153,989,236 M476K possibly damaging Het
Csf1 T C 3: 107,753,856 D115G probably damaging Het
Dclre1b C A 3: 103,807,243 probably benign Het
Fbp1 A G 13: 62,875,261 L74P probably damaging Het
Gm9573 G T 17: 35,620,604 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hydin G T 8: 110,563,865 V3319L probably benign Het
Kcna4 A G 2: 107,296,007 N362S probably benign Het
Kif13a C T 13: 46,814,155 probably null Het
Lingo2 T C 4: 35,708,810 E390G probably benign Het
Mdh1 T G 11: 21,566,624 D33A possibly damaging Het
Mov10 C T 3: 104,818,465 G21D probably damaging Het
Olfr1305 G A 2: 111,873,439 R139W possibly damaging Het
Olfr851 T A 9: 19,496,877 L43Q probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Pik3c2g T A 6: 139,633,751 Y332N probably damaging Het
Rims2 A G 15: 39,462,560 S763G probably damaging Het
Sarm1 T A 11: 78,497,101 I120L probably benign Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Snx31 A G 15: 36,546,111 probably benign Het
Tmem150a C T 6: 72,357,052 S39F probably benign Het
Tsc2 T A 17: 24,597,264 H1605L probably damaging Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Vmn2r95 T C 17: 18,452,245 L820P probably damaging Het
Zfp36l3 T C X: 53,775,957 N97D possibly damaging Het
Other mutations in Rab22a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Rab22a APN 2 173688210 missense probably damaging 1.00
IGL01889:Rab22a APN 2 173688238 intron probably benign
IGL03113:Rab22a APN 2 173661472 missense probably damaging 1.00
PIT1430001:Rab22a UTSW 2 173695170 missense probably benign 0.09
R0304:Rab22a UTSW 2 173661459 missense probably damaging 1.00
R1937:Rab22a UTSW 2 173688211 missense probably damaging 1.00
R2914:Rab22a UTSW 2 173695281 missense probably benign 0.00
R4473:Rab22a UTSW 2 173695263 missense probably damaging 1.00
R4476:Rab22a UTSW 2 173695263 missense probably damaging 1.00
R4559:Rab22a UTSW 2 173661433 missense probably damaging 1.00
R5163:Rab22a UTSW 2 173661487 missense probably damaging 0.99
R5934:Rab22a UTSW 2 173661504 missense probably damaging 1.00
R6753:Rab22a UTSW 2 173701055 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGCAGGGATAATGGACTTC -3'
(R):5'- ACCCTGGATGTGGCTCATTAG -3'

Sequencing Primer
(F):5'- GCTAAAAGGACATCTTTCCCTG -3'
(R):5'- CCCTGGATGTGGCTCATTAGAAAAG -3'
Posted On2015-07-21