Incidental Mutation 'R0052:Psd3'
ID33048
Institutional Source Beutler Lab
Gene Symbol Psd3
Ensembl Gene ENSMUSG00000030465
Gene Namepleckstrin and Sec7 domain containing 3
SynonymsEFA6D, 4931420C21Rik
MMRRC Submission 038346-MU
Accession Numbers

Ncbi RefSeq: NM_030263.5, NM_027626.1; MGI:1918215

Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R0052 (G1)
Quality Score95
Status Validated
Chromosome8
Chromosomal Location67689082-68212027 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 67882979 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038959] [ENSMUST00000093468] [ENSMUST00000093469] [ENSMUST00000098696] [ENSMUST00000212505] [ENSMUST00000212960]
Predicted Effect probably null
Transcript: ENSMUST00000038959
SMART Domains Protein: ENSMUSP00000041339
Gene: ENSMUSG00000030465

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
Blast:Sec7 431 496 5e-28 BLAST
Sec7 502 693 3.9e-53 SMART
PH 743 857 3.85e-15 SMART
Blast:Sec7 876 938 2e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000093468
SMART Domains Protein: ENSMUSP00000091178
Gene: ENSMUSG00000030465

DomainStartEndE-ValueType
Sec7 17 206 1.35e-56 SMART
PH 256 370 3.85e-15 SMART
Blast:Sec7 389 451 1e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000093469
SMART Domains Protein: ENSMUSP00000091179
Gene: ENSMUSG00000030465

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
Blast:Sec7 431 496 5e-28 BLAST
Sec7 502 692 2.4e-53 SMART
PH 742 856 3.85e-15 SMART
Blast:Sec7 875 937 2e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000098696
SMART Domains Protein: ENSMUSP00000096293
Gene: ENSMUSG00000030465

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
Blast:Sec7 431 496 5e-28 BLAST
Sec7 502 692 2.4e-53 SMART
PH 742 856 3.85e-15 SMART
Blast:Sec7 875 937 2e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150169
Predicted Effect probably null
Transcript: ENSMUST00000212505
Predicted Effect probably null
Transcript: ENSMUST00000212960
Meta Mutation Damage Score 0.426 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,915,951 S438P possibly damaging Het
Atp2a1 A G 7: 126,457,897 probably benign Het
Axin2 T C 11: 108,949,270 Y735H probably damaging Het
Bicd2 T A 13: 49,375,314 L184Q probably damaging Het
Bub1 G A 2: 127,809,039 T618I probably benign Het
Catsperg2 A G 7: 29,725,020 probably benign Het
Ccdc73 T A 2: 104,929,570 probably benign Het
Crybg3 A T 16: 59,565,656 probably benign Het
Dsp A G 13: 38,197,364 D2096G possibly damaging Het
Eef2 C CN 10: 81,178,768 probably null Het
Elp3 A G 14: 65,531,526 *548Q probably null Het
Eno4 A G 19: 58,968,553 D357G probably damaging Het
Fam214a A G 9: 75,018,983 probably benign Het
Fcrls A T 3: 87,256,778 I348N possibly damaging Het
Fgl2 A T 5: 21,375,349 S230C probably damaging Het
Ginm1 T A 10: 7,779,306 E57D possibly damaging Het
Gtf3c1 A T 7: 125,667,971 probably null Het
Herc1 G T 9: 66,400,156 G1044V probably damaging Het
Hmcn1 G A 1: 150,677,406 T2511M probably damaging Het
Iba57 C T 11: 59,158,901 A207T probably benign Het
Itga9 T A 9: 118,636,549 I157N probably damaging Het
Kalrn A G 16: 34,357,171 L208P probably damaging Het
Kcnj10 A G 1: 172,368,924 T2A probably benign Het
Kdm1b T A 13: 47,064,117 C351S probably damaging Het
Kif21a T C 15: 90,970,857 E700G probably damaging Het
Mmd C T 11: 90,259,998 probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Morn3 T C 5: 123,046,663 Y38C probably damaging Het
Nacc1 A T 8: 84,676,225 V313D probably benign Het
Nbeal1 T A 1: 60,228,612 probably benign Het
Neb T C 2: 52,273,980 K1989E possibly damaging Het
Nlrp3 C T 11: 59,565,128 R917* probably null Het
Nlrp4b T A 7: 10,725,962 Y463* probably null Het
Perm1 A T 4: 156,218,115 D372V probably damaging Het
Phf3 T C 1: 30,808,767 T1232A probably damaging Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Pld4 T A 12: 112,767,857 F386I probably benign Het
Prex2 T A 1: 11,160,156 L802Q probably damaging Het
Ralgds T A 2: 28,544,388 probably null Het
Rmdn2 A G 17: 79,650,331 E16G probably damaging Het
Rnf111 A T 9: 70,476,389 S87R probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc9c1 A G 16: 45,606,856 probably benign Het
Slco3a1 A T 7: 74,504,326 I166N probably benign Het
Snx5 A T 2: 144,259,192 probably null Het
Srgap1 T C 10: 121,800,827 D741G possibly damaging Het
St8sia2 G T 7: 73,943,290 Y339* probably null Het
St8sia2 A T 7: 73,971,952 W86R probably damaging Het
Stk33 A G 7: 109,279,669 L491P possibly damaging Het
Sult2a7 T C 7: 14,465,208 Y298C probably damaging Het
Tdo2 T A 3: 81,967,025 N210I probably benign Het
Thada A T 17: 84,455,158 N104K probably damaging Het
Timm8b A T 9: 50,605,030 D61V possibly damaging Het
Tshz1 G A 18: 84,014,945 T446I possibly damaging Het
Ubap2l T C 3: 90,038,928 N123S possibly damaging Het
Vmn1r48 T C 6: 90,036,264 E193G possibly damaging Het
Vmn1r69 C T 7: 10,580,400 V135I probably benign Het
Vmn2r103 G T 17: 19,811,641 G559V probably benign Het
Vmn2r26 T A 6: 124,062,033 *856R probably null Het
Vmn2r88 A G 14: 51,418,700 I798V possibly damaging Het
Vsir C T 10: 60,358,082 A108V probably benign Het
Zfp14 G T 7: 30,038,328 Q411K probably damaging Het
Zfp236 A T 18: 82,639,332 M762K probably damaging Het
Zfp462 G A 4: 55,011,762 G1243S probably benign Het
Other mutations in Psd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Psd3 APN 8 67908679 splice site probably benign
IGL01095:Psd3 APN 8 67908513 missense probably damaging 1.00
IGL01139:Psd3 APN 8 67908535 missense probably damaging 1.00
IGL01330:Psd3 APN 8 67697178 missense probably damaging 1.00
IGL01350:Psd3 APN 8 67720892 missense probably damaging 1.00
IGL01487:Psd3 APN 8 67697114 missense probably benign 0.01
IGL01780:Psd3 APN 8 67963869 missense probably benign
IGL02020:Psd3 APN 8 67974170 intron probably benign
IGL02232:Psd3 APN 8 67904145 missense probably damaging 1.00
IGL02350:Psd3 APN 8 67963869 missense probably benign
IGL02357:Psd3 APN 8 67963869 missense probably benign
PIT4495001:Psd3 UTSW 8 67963913 missense probably benign 0.00
R0052:Psd3 UTSW 8 67882979 critical splice donor site probably null
R0242:Psd3 UTSW 8 67758086 missense probably damaging 0.99
R0242:Psd3 UTSW 8 67758086 missense probably damaging 0.99
R0581:Psd3 UTSW 8 67720946 missense probably damaging 1.00
R0655:Psd3 UTSW 8 67963689 missense probably benign 0.19
R1740:Psd3 UTSW 8 68120839 missense probably damaging 1.00
R1789:Psd3 UTSW 8 67960565 missense probably benign 0.26
R1847:Psd3 UTSW 8 67720004 missense possibly damaging 0.93
R1951:Psd3 UTSW 8 67963487 missense probably benign 0.00
R1954:Psd3 UTSW 8 67697075 missense probably damaging 1.00
R2143:Psd3 UTSW 8 67964351 missense probably damaging 1.00
R4387:Psd3 UTSW 8 68000761 missense probably damaging 1.00
R4801:Psd3 UTSW 8 68121148 missense probably benign
R4802:Psd3 UTSW 8 68121148 missense probably benign
R4913:Psd3 UTSW 8 68121169 missense probably damaging 0.99
R5045:Psd3 UTSW 8 67713825 missense probably damaging 0.99
R5173:Psd3 UTSW 8 67696989 missense probably damaging 1.00
R5264:Psd3 UTSW 8 67713725 missense probably benign 0.23
R5350:Psd3 UTSW 8 67908861 missense probably benign 0.00
R5816:Psd3 UTSW 8 67960510 missense possibly damaging 0.90
R5994:Psd3 UTSW 8 67719968 missense probably damaging 1.00
R6157:Psd3 UTSW 8 68121527 start codon destroyed probably benign 0.14
R6241:Psd3 UTSW 8 67818139 intron probably benign
R6586:Psd3 UTSW 8 67963545 missense probably damaging 0.96
R6735:Psd3 UTSW 8 68120746 critical splice donor site probably null
R6908:Psd3 UTSW 8 67964177 missense probably benign 0.00
R6984:Psd3 UTSW 8 67818045 missense possibly damaging 0.85
R7082:Psd3 UTSW 8 67904148 missense probably benign 0.03
R7116:Psd3 UTSW 8 67713738 missense probably benign 0.12
R7297:Psd3 UTSW 8 68121034 missense probably damaging 0.98
Z1088:Psd3 UTSW 8 67906260 splice site silent
Predicted Primers PCR Primer
(F):5'- CCGTGACTGAGGAAGTCTACAATGC -3'
(R):5'- GCTCCTTCACATGTACTTGCCAGAG -3'

Sequencing Primer
(F):5'- ACTTACTGTGATGCAGACTGTCAG -3'
(R):5'- acatgtacttgccaGAGTGTAAGG -3'
Posted On2013-05-09