Incidental Mutation 'R4476:Acin1'
ID330571
Institutional Source Beutler Lab
Gene Symbol Acin1
Ensembl Gene ENSMUSG00000022185
Gene Nameapoptotic chromatin condensation inducer 1
Synonyms2610510L13Rik, Acinus, 2610036I19Rik
MMRRC Submission 041733-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R4476 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54642161-54686931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54645330 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 275 (R275G)
Ref Sequence ENSEMBL: ENSMUSP00000118069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022793] [ENSMUST00000022794] [ENSMUST00000067784] [ENSMUST00000111484] [ENSMUST00000123875] [ENSMUST00000126166] [ENSMUST00000141453] [ENSMUST00000148754] [ENSMUST00000150371] [ENSMUST00000167015] [ENSMUST00000169818]
Predicted Effect probably damaging
Transcript: ENSMUST00000022793
AA Change: R979G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022793
Gene: ENSMUSG00000022185
AA Change: R979G

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 175 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 414 423 N/A INTRINSIC
low complexity region 573 603 N/A INTRINSIC
low complexity region 631 662 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
low complexity region 760 773 N/A INTRINSIC
low complexity region 778 792 N/A INTRINSIC
low complexity region 803 813 N/A INTRINSIC
internal_repeat_1 817 892 1.63e-6 PROSPERO
low complexity region 927 952 N/A INTRINSIC
RRM 1012 1081 8.3e-2 SMART
Pfam:RSB_motif 1139 1246 5.7e-30 PFAM
low complexity region 1275 1329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000022794
AA Change: R221G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022794
Gene: ENSMUSG00000022185
AA Change: R221G

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 169 194 N/A INTRINSIC
RRM 254 323 8.3e-2 SMART
low complexity region 355 405 N/A INTRINSIC
low complexity region 412 450 N/A INTRINSIC
PDB:4A8X|B 451 475 4e-6 PDB
low complexity region 477 512 N/A INTRINSIC
low complexity region 517 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067784
SMART Domains Protein: ENSMUSP00000066005
Gene: ENSMUSG00000059674

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 67 148 7.85e-18 SMART
CA 172 257 3.23e-28 SMART
CA 281 369 4.24e-14 SMART
CA 396 477 1.48e-22 SMART
Blast:CA 500 581 3e-31 BLAST
transmembrane domain 602 624 N/A INTRINSIC
Pfam:Cadherin_C 627 775 2e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111484
AA Change: R939G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107109
Gene: ENSMUSG00000022185
AA Change: R939G

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 172 N/A INTRINSIC
coiled coil region 219 260 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 591 622 N/A INTRINSIC
low complexity region 694 703 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 738 752 N/A INTRINSIC
low complexity region 763 773 N/A INTRINSIC
internal_repeat_1 777 852 1.21e-6 PROSPERO
low complexity region 887 912 N/A INTRINSIC
RRM 972 1041 8.3e-2 SMART
low complexity region 1073 1123 N/A INTRINSIC
low complexity region 1130 1168 N/A INTRINSIC
coiled coil region 1188 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123875
SMART Domains Protein: ENSMUSP00000117210
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
low complexity region 112 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125767
Predicted Effect probably damaging
Transcript: ENSMUST00000126166
AA Change: R206G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114546
Gene: ENSMUSG00000022185
AA Change: R206G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 30 40 N/A INTRINSIC
low complexity region 154 179 N/A INTRINSIC
RRM 239 308 8.3e-2 SMART
low complexity region 340 390 N/A INTRINSIC
low complexity region 397 435 N/A INTRINSIC
PDB:4A8X|B 436 460 4e-6 PDB
low complexity region 462 497 N/A INTRINSIC
low complexity region 502 556 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133706
Predicted Effect probably benign
Transcript: ENSMUST00000138321
SMART Domains Protein: ENSMUSP00000119326
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
Pfam:RSB_motif 20 128 4.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141453
AA Change: R193G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116664
Gene: ENSMUSG00000022185
AA Change: R193G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 30 40 N/A INTRINSIC
low complexity region 141 166 N/A INTRINSIC
RRM 226 295 8.3e-2 SMART
low complexity region 327 377 N/A INTRINSIC
low complexity region 384 422 N/A INTRINSIC
PDB:4A8X|B 423 447 4e-6 PDB
low complexity region 449 484 N/A INTRINSIC
low complexity region 489 543 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147714
AA Change: R912G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119080
Gene: ENSMUSG00000022185
AA Change: R912G

DomainStartEndE-ValueType
SAP 18 52 1.29e-8 SMART
coiled coil region 83 120 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
coiled coil region 204 245 N/A INTRINSIC
low complexity region 324 342 N/A INTRINSIC
low complexity region 360 369 N/A INTRINSIC
low complexity region 519 549 N/A INTRINSIC
low complexity region 577 608 N/A INTRINSIC
low complexity region 680 689 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
low complexity region 861 886 N/A INTRINSIC
RRM 946 1015 8.3e-2 SMART
Pfam:RSB_motif 1065 1180 1.1e-29 PFAM
low complexity region 1209 1263 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148754
AA Change: R222G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122003
Gene: ENSMUSG00000022185
AA Change: R222G

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
RRM 255 324 8.3e-2 SMART
low complexity region 356 406 N/A INTRINSIC
low complexity region 413 451 N/A INTRINSIC
PDB:4A8X|B 452 476 4e-6 PDB
low complexity region 478 513 N/A INTRINSIC
low complexity region 518 572 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150371
AA Change: R275G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118069
Gene: ENSMUSG00000022185
AA Change: R275G

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
low complexity region 223 248 N/A INTRINSIC
RRM 308 377 8.3e-2 SMART
low complexity region 409 459 N/A INTRINSIC
low complexity region 466 504 N/A INTRINSIC
PDB:4A8X|B 505 529 3e-6 PDB
low complexity region 531 566 N/A INTRINSIC
low complexity region 571 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152773
Predicted Effect probably damaging
Transcript: ENSMUST00000167015
AA Change: R222G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125776
Gene: ENSMUSG00000022185
AA Change: R222G

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
RRM 255 324 8.3e-2 SMART
low complexity region 356 406 N/A INTRINSIC
low complexity region 413 451 N/A INTRINSIC
PDB:4A8X|B 452 476 4e-6 PDB
low complexity region 478 513 N/A INTRINSIC
low complexity region 518 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167495
Predicted Effect probably benign
Transcript: ENSMUST00000169818
SMART Domains Protein: ENSMUSP00000131860
Gene: ENSMUSG00000091306

DomainStartEndE-ValueType
low complexity region 1 61 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196776
Meta Mutation Damage Score 0.0268 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is defined by several morphologic nuclear changes, including chromatin condensation and nuclear fragmentation. This gene encodes a nuclear protein that induces apoptotic chromatin condensation after activation by caspase-3, without inducing DNA fragmentation. This protein has also been shown to be a component of a splicing-dependent multiprotein exon junction complex (EJC) that is deposited at splice junctions on mRNAs, as a consequence of pre-mRNA splicing. It may thus be involved in mRNA metabolism associated with splicing. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actc1 T C 2: 114,049,226 T251A probably benign Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Arsb C T 13: 93,807,595 R265C probably damaging Het
Cntn6 A G 6: 104,772,561 E319G probably damaging Het
Cracr2a T A 6: 127,629,819 N275K probably benign Het
Crispld1 G T 1: 17,747,510 W212C probably damaging Het
Exosc10 G A 4: 148,565,324 D404N probably damaging Het
Gfpt2 T C 11: 49,824,342 V388A probably benign Het
Gm14401 C T 2: 177,086,777 R219* probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itgb1bp1 T C 12: 21,270,956 E178G probably benign Het
Kidins220 C T 12: 25,011,001 S826L probably damaging Het
Krt90 T C 15: 101,557,283 D301G probably damaging Het
Me3 T A 7: 89,739,860 V124E probably damaging Het
Nedd4 C T 9: 72,671,239 R78* probably null Het
Neto1 A T 18: 86,404,673 D85V probably damaging Het
Olfr1288 T A 2: 111,479,664 D293E possibly damaging Het
Olfr361 G A 2: 37,085,061 S229L probably damaging Het
Olfr538 T C 7: 140,574,929 Y259H probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Pkd1 A G 17: 24,576,526 E2331G probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Rab23 A G 1: 33,724,892 probably benign Het
Sim2 T C 16: 94,125,791 S625P probably benign Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tanc1 A G 2: 59,841,996 probably null Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Zfp667 A G 7: 6,304,599 K89E possibly damaging Het
Other mutations in Acin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Acin1 APN 14 54646800 missense probably damaging 1.00
IGL01530:Acin1 APN 14 54643986 missense probably damaging 1.00
IGL02396:Acin1 APN 14 54644799 intron probably benign
IGL02967:Acin1 APN 14 54642753 missense possibly damaging 0.80
Protuberant UTSW 14 54645283 missense probably damaging 1.00
R0411:Acin1 UTSW 14 54646774 missense probably damaging 1.00
R0723:Acin1 UTSW 14 54665451 missense probably damaging 0.98
R0755:Acin1 UTSW 14 54651835 start codon destroyed probably null 0.93
R0784:Acin1 UTSW 14 54653528 unclassified probably benign
R1600:Acin1 UTSW 14 54643717 intron probably benign
R1682:Acin1 UTSW 14 54663718 missense probably damaging 1.00
R1721:Acin1 UTSW 14 54664538 missense probably benign 0.01
R1756:Acin1 UTSW 14 54665204 missense probably benign 0.30
R1867:Acin1 UTSW 14 54644261 missense probably damaging 1.00
R1997:Acin1 UTSW 14 54646699 splice site probably null
R2067:Acin1 UTSW 14 54665254 missense probably damaging 1.00
R3947:Acin1 UTSW 14 54679333 missense possibly damaging 0.89
R4374:Acin1 UTSW 14 54653894 unclassified probably benign
R4501:Acin1 UTSW 14 54686587 missense probably damaging 1.00
R4547:Acin1 UTSW 14 54645667 missense probably benign 0.01
R4621:Acin1 UTSW 14 54653443 unclassified probably benign
R4657:Acin1 UTSW 14 54643047 missense possibly damaging 0.93
R4680:Acin1 UTSW 14 54686758 missense probably benign 0.00
R4696:Acin1 UTSW 14 54643017 intron probably benign
R4806:Acin1 UTSW 14 54679228 splice site probably benign
R4826:Acin1 UTSW 14 54664617 missense probably damaging 0.97
R5096:Acin1 UTSW 14 54679222 intron probably benign
R5153:Acin1 UTSW 14 54645613 missense probably benign 0.25
R5223:Acin1 UTSW 14 54642941 frame shift probably null
R5260:Acin1 UTSW 14 54642822 intron probably benign
R5525:Acin1 UTSW 14 54664391 missense possibly damaging 0.94
R5575:Acin1 UTSW 14 54678738 splice site probably null
R5902:Acin1 UTSW 14 54663673 missense probably benign 0.01
R6211:Acin1 UTSW 14 54644046 missense probably damaging 1.00
R6524:Acin1 UTSW 14 54645283 missense probably damaging 1.00
R6560:Acin1 UTSW 14 54678833 missense probably benign 0.24
R6916:Acin1 UTSW 14 54665416 missense probably benign 0.27
R7201:Acin1 UTSW 14 54664899 missense possibly damaging 0.83
X0021:Acin1 UTSW 14 54667101 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGGGAATGATCTCCATG -3'
(R):5'- GTCTCGCAGTGAGGTTCTAC -3'

Sequencing Primer
(F):5'- TAAGTCCTCTTCAACAGCAGTGAGG -3'
(R):5'- CAGTGAGGTTCTACGCTTGCC -3'
Posted On2015-07-21