Incidental Mutation 'R4488:Cryz'
ID330583
Institutional Source Beutler Lab
Gene Symbol Cryz
Ensembl Gene ENSMUSG00000028199
Gene Namecrystallin, zeta
SynonymsSez9, quinone reductase, SEZ9
MMRRC Submission 041744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R4488 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location154596711-154623182 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 154618457 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029850] [ENSMUST00000135723] [ENSMUST00000144764] [ENSMUST00000155232] [ENSMUST00000184537] [ENSMUST00000192462] [ENSMUST00000194876]
Predicted Effect probably benign
Transcript: ENSMUST00000029850
SMART Domains Protein: ENSMUSP00000029850
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 131 3.3e-14 PFAM
Pfam:ADH_zinc_N 160 290 1.3e-30 PFAM
Pfam:ADH_zinc_N_2 192 329 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135723
SMART Domains Protein: ENSMUSP00000143311
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
PDB:1YB5|B 1 38 5e-17 PDB
SCOP:d1qora1 9 38 9e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144764
SMART Domains Protein: ENSMUSP00000121269
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 132 2.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155232
SMART Domains Protein: ENSMUSP00000118449
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 135 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184537
SMART Domains Protein: ENSMUSP00000139387
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 180 4.7e-17 PFAM
Pfam:ADH_zinc_N 160 218 5.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192462
SMART Domains Protein: ENSMUSP00000142105
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 131 2.8e-16 PFAM
Pfam:ADH_zinc_N 160 290 1.8e-29 PFAM
Pfam:ADH_zinc_N_2 192 329 4.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194876
SMART Domains Protein: ENSMUSP00000142101
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 139 2.2e-14 PFAM
Pfam:ADH_zinc_N 160 290 1.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195292
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. The former class is also called phylogenetically-restricted crystallins. This gene encodes a taxon-specific crystallin protein which has NADPH-dependent quinone reductase activity distinct from other known quinone reductases. It lacks alcohol dehydrogenase activity although by similarity it is considered a member of the zinc-containing alcohol dehydrogenase family. Unlike other mammalian species, in humans, lens expression is low. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. One pseudogene is known to exist. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Alkal1 A T 1: 6,359,407 Q26L probably benign Het
Brox A G 1: 183,280,950 L280S probably benign Het
Cep41 A T 6: 30,655,689 probably benign Het
Cyp26c1 T C 19: 37,693,210 V487A probably benign Het
Dlx6 T C 6: 6,867,207 M270T probably damaging Het
Glb1 T C 9: 114,443,114 I273T probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hcrtr1 A G 4: 130,135,763 V175A probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kif1bp A G 10: 62,563,027 probably benign Het
Mki67 G A 7: 135,697,671 T1878I probably benign Het
Ncoa6 A G 2: 155,407,476 F1303L possibly damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nutf2 T A 8: 105,876,427 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Rbm45 T C 2: 76,376,396 S251P probably damaging Het
Rnaset2b A G 17: 6,998,070 Y155C probably damaging Het
Rnf122 A G 8: 31,128,255 T92A probably damaging Het
Rnf220 A G 4: 117,489,814 S134P probably damaging Het
Shprh A T 10: 11,160,471 I351F probably benign Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Sulf1 G T 1: 12,786,515 probably benign Het
Svil T C 18: 5,049,067 Y202H probably damaging Het
Tek A G 4: 94,849,756 D681G possibly damaging Het
Tra2a A G 6: 49,252,494 probably benign Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r25 A T 6: 123,822,860 I841N probably damaging Het
Zfp949 T C 9: 88,570,089 S571P probably damaging Het
Zkscan16 A G 4: 58,957,431 E571G possibly damaging Het
Zufsp G A 10: 33,948,964 T174I probably damaging Het
Other mutations in Cryz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Cryz APN 3 154604942 missense possibly damaging 0.95
IGL00838:Cryz APN 3 154618475 missense probably damaging 1.00
IGL00969:Cryz APN 3 154618526 nonsense probably null
IGL01571:Cryz APN 3 154621743 missense probably damaging 1.00
IGL03082:Cryz APN 3 154604926 missense probably damaging 1.00
R0049:Cryz UTSW 3 154611552 missense probably damaging 1.00
R0049:Cryz UTSW 3 154611552 missense probably damaging 1.00
R1116:Cryz UTSW 3 154621603 splice site probably benign
R1470:Cryz UTSW 3 154606476 missense probably damaging 1.00
R1470:Cryz UTSW 3 154606476 missense probably damaging 1.00
R1586:Cryz UTSW 3 154611510 missense probably benign 0.00
R2018:Cryz UTSW 3 154621683 missense probably damaging 1.00
R2223:Cryz UTSW 3 154618554 missense possibly damaging 0.86
R2334:Cryz UTSW 3 154622191 missense probably benign 0.04
R5547:Cryz UTSW 3 154611557 nonsense probably null
R5595:Cryz UTSW 3 154606518 missense probably damaging 1.00
R5917:Cryz UTSW 3 154621766 missense probably benign 0.05
R7197:Cryz UTSW 3 154621568 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGGAAAGTTCAACACCAG -3'
(R):5'- CCCAGAAGCAAAGTTTGACC -3'

Sequencing Primer
(F):5'- GTTCAACACCAGAGCAGCGG -3'
(R):5'- CAGAAGCAAAGTTTGACCTTAAACTG -3'
Posted On2015-07-21