Incidental Mutation 'R0069:Creb1'
ID33078
Institutional Source Beutler Lab
Gene Symbol Creb1
Ensembl Gene ENSMUSG00000025958
Gene NamecAMP responsive element binding protein 1
Synonyms3526402H21Rik, Creb-1, 2310001E10Rik, Creb
MMRRC Submission 038360-MU
Accession Numbers

Genbank: NM_009952.2, NM_133828.2, NM_001037726.1

Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R0069 (G1)
Quality Score202
Status Validated (trace)
Chromosome1
Chromosomal Location64532645-64604548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64576208 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 240 (I240V)
Ref Sequence ENSEMBL: ENSMUSP00000140649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049932] [ENSMUST00000087366] [ENSMUST00000171164] [ENSMUST00000185594] [ENSMUST00000187811] [ENSMUST00000190348] [ENSMUST00000190876]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049932
AA Change: I254V

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000059973
Gene: ENSMUSG00000025958
AA Change: I254V

DomainStartEndE-ValueType
internal_repeat_1 16 89 5.16e-5 PROSPERO
Pfam:pKID 113 153 7.7e-24 PFAM
low complexity region 162 174 N/A INTRINSIC
internal_repeat_1 184 260 5.16e-5 PROSPERO
BRLZ 281 339 1.25e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000087366
AA Change: I240V

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084624
Gene: ENSMUSG00000025958
AA Change: I240V

DomainStartEndE-ValueType
internal_repeat_1 16 90 1.46e-5 PROSPERO
Pfam:pKID 99 141 5.3e-24 PFAM
low complexity region 148 160 N/A INTRINSIC
internal_repeat_1 170 247 1.46e-5 PROSPERO
BRLZ 267 325 1.25e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171164
AA Change: I200V

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132860
Gene: ENSMUSG00000025958
AA Change: I200V

DomainStartEndE-ValueType
Pfam:pKID 59 101 9e-24 PFAM
low complexity region 108 120 N/A INTRINSIC
BRLZ 227 285 1.25e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185594
AA Change: I240V

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139995
Gene: ENSMUSG00000025958
AA Change: I240V

DomainStartEndE-ValueType
internal_repeat_1 16 90 1.46e-5 PROSPERO
Pfam:pKID 99 141 5.3e-24 PFAM
low complexity region 148 160 N/A INTRINSIC
internal_repeat_1 170 247 1.46e-5 PROSPERO
BRLZ 267 325 1.25e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186335
Predicted Effect possibly damaging
Transcript: ENSMUST00000187811
AA Change: I240V

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140649
Gene: ENSMUSG00000025958
AA Change: I240V

DomainStartEndE-ValueType
Pfam:pKID 99 141 3.8e-21 PFAM
low complexity region 148 160 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190348
AA Change: I254V

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140112
Gene: ENSMUSG00000025958
AA Change: I254V

DomainStartEndE-ValueType
internal_repeat_1 16 89 5.16e-5 PROSPERO
Pfam:pKID 113 155 1.2e-23 PFAM
low complexity region 162 174 N/A INTRINSIC
internal_repeat_1 184 260 5.16e-5 PROSPERO
BRLZ 281 339 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190979
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for alleles lacking some or all isotypes exhibit a range of defects involving circadian rhythms, axonal growth, sensory neuron survival, long-term memory, fear conditioning, body size, respiration, and neonatal viability. [provided by MGI curators]
Allele List at MGI

All alleles(85) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(76)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,561,562 C632S probably damaging Het
Antxr2 T A 5: 97,948,250 M392L possibly damaging Het
Cd101 A G 3: 101,008,217 V678A probably benign Het
Clec2g T A 6: 128,948,753 S42T probably benign Het
Clec2g T C 6: 128,980,311 probably null Het
D2hgdh G T 1: 93,835,287 V265L possibly damaging Het
Dctn2 A T 10: 127,277,485 probably null Het
Diablo A T 5: 123,518,024 S117R probably damaging Het
Ebf2 A T 14: 67,410,050 R349S probably damaging Het
Fam168a C T 7: 100,835,411 A252V probably benign Het
Fbn2 T C 18: 58,069,184 Y1299C probably damaging Het
Gne A C 4: 44,060,099 V98G probably damaging Het
Hk2 A G 6: 82,736,528 probably null Het
Ifi206 A T 1: 173,486,847 V9D probably damaging Het
Ints3 A G 3: 90,400,647 probably benign Het
Itgal A G 7: 127,310,331 T56A probably benign Het
Lzts3 T A 2: 130,636,540 T213S probably benign Het
Map1b A G 13: 99,429,848 S2122P unknown Het
Mei4 C T 9: 82,025,582 Q223* probably null Het
Mpzl3 T C 9: 45,068,252 V167A probably damaging Het
Myo1d A G 11: 80,637,953 I681T probably damaging Het
Myom2 A G 8: 15,117,624 T1070A probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Nfx1 T C 4: 40,986,688 probably benign Het
Olfr1335 A T 4: 118,809,690 V58D probably damaging Het
Olfr952 A G 9: 39,426,892 Y60H probably damaging Het
Ostm1 A C 10: 42,692,956 D37A probably benign Het
Pde8a T C 7: 81,319,123 probably benign Het
Pole2 A T 12: 69,209,887 V288E probably damaging Het
Poteg T C 8: 27,447,821 S2P probably benign Het
Ppp2r5c A T 12: 110,567,770 M356L probably benign Het
Prkdc G A 16: 15,726,504 S1786N probably benign Het
Prox1 A G 1: 190,160,919 V443A possibly damaging Het
Prpf6 T A 2: 181,615,963 probably null Het
Ptger1 A T 8: 83,668,319 T142S possibly damaging Het
Rad54l2 C A 9: 106,710,365 V734L possibly damaging Het
Rnpepl1 T A 1: 92,918,898 N507K possibly damaging Het
Slc38a10 A T 11: 120,106,502 V722E probably damaging Het
Slfn10-ps A G 11: 83,035,542 noncoding transcript Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sult1e1 A T 5: 87,579,897 H175Q probably damaging Het
Ube2e3 C A 2: 78,919,949 probably benign Het
Vmn1r208 A T 13: 22,772,425 W301R probably benign Het
Vps13d A G 4: 145,062,563 I746T probably benign Het
Xpnpep3 T C 15: 81,430,798 V233A probably benign Het
Zfp329 A T 7: 12,810,932 S222T probably damaging Het
Zswim6 T C 13: 107,738,563 noncoding transcript Het
Other mutations in Creb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Creb1 APN 1 64570125 splice site probably benign
IGL01991:Creb1 APN 1 64559754 missense probably benign
IGL03137:Creb1 APN 1 64576215 missense possibly damaging 0.95
IGL03408:Creb1 APN 1 64576332 splice site probably null
1mM(1):Creb1 UTSW 1 64574171 nonsense probably null
R0028:Creb1 UTSW 1 64570148 missense probably damaging 0.96
R0069:Creb1 UTSW 1 64576208 missense possibly damaging 0.91
R0506:Creb1 UTSW 1 64570267 missense probably damaging 1.00
R1834:Creb1 UTSW 1 64550950 nonsense probably null
R1835:Creb1 UTSW 1 64550950 nonsense probably null
R1836:Creb1 UTSW 1 64550950 nonsense probably null
R7254:Creb1 UTSW 1 64576277 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTAGATAGAGTCCCATTCCCTGTTTCCC -3'
(R):5'- GTAAAGAAAGCCCCTGCCCCTAAG -3'

Sequencing Primer
(F):5'- ATTCCCTGTTTCCCTTTTAATCTAAG -3'
(R):5'- GACTGACCTAAAGTTCCATTAGC -3'
Posted On2013-05-09