Incidental Mutation 'R4492:Irgm1'
List |< first << previous [record 95 of 217] next >> last >|
ID330793
Institutional Source Beutler Lab
Gene Symbol Irgm1
Ensembl Gene ENSMUSG00000046879
Gene Nameimmunity-related GTPase family M member 1
SynonymsIfi1, LRG-47, Irgm, Iigp3
MMRRC Submission 041581-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4492 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location48861968-48871683 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) G to A at 48866128 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000094870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049519] [ENSMUST00000097271]
Predicted Effect silent
Transcript: ENSMUST00000049519
SMART Domains Protein: ENSMUSP00000050446
Gene: ENSMUSG00000046879

DomainStartEndE-ValueType
Pfam:IIGP 42 399 5.5e-169 PFAM
Predicted Effect silent
Transcript: ENSMUST00000097271
SMART Domains Protein: ENSMUSP00000094870
Gene: ENSMUSG00000046879

DomainStartEndE-ValueType
Pfam:IIGP 26 288 2.5e-131 PFAM
Pfam:MMR_HSR1 62 175 2.8e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147151
Meta Mutation Damage Score 0.6092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: In the absence of infection, mice show no overt phenotype. Resistance to protozoan parasitic infection and bacterial infection is impaired in homozygous mutant mice, whereas resistance to viral infection is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 T G 10: 89,725,814 I157L probably benign Het
Amph T C 13: 19,149,758 V663A possibly damaging Het
Anapc16 A G 10: 59,990,902 S50P possibly damaging Het
Ank3 T A 10: 69,808,925 V60D probably damaging Het
Btbd9 A G 17: 30,527,571 Y94H probably damaging Het
Chil3 A G 3: 106,155,701 I191T probably damaging Het
Clpb T C 7: 101,787,722 L668P probably damaging Het
Cyp2d22 G A 15: 82,374,370 H97Y probably benign Het
Dhrs7 A T 12: 72,653,125 N244K probably damaging Het
Dusp4 C T 8: 34,807,736 T3M possibly damaging Het
Edc4 GGATTTTAGCCA G 8: 105,885,068 probably null Het
Etl4 G A 2: 20,806,865 S1621N possibly damaging Het
Fam174a T C 1: 95,313,976 S54P probably benign Het
Fdxacb1 T C 9: 50,770,247 F7S probably damaging Het
Focad G A 4: 88,359,905 probably null Het
Gpr156 T A 16: 37,992,106 L268H probably damaging Het
Gpr17 A T 18: 31,947,251 I253N possibly damaging Het
H2-T23 A T 17: 36,032,166 N106K probably damaging Het
Hspa4 T C 11: 53,280,469 R303G probably damaging Het
Jph1 A C 1: 16,997,546 I114S probably damaging Het
Kcna1 C T 6: 126,642,275 D361N possibly damaging Het
Kcna4 G A 2: 107,296,091 R390Q probably damaging Het
Lum C A 10: 97,568,438 P65H probably damaging Het
Mc4r A G 18: 66,859,640 L134P probably benign Het
Mroh8 A T 2: 157,258,040 I248N probably damaging Het
Nos2 A G 11: 78,950,095 T677A probably benign Het
Nup37 T A 10: 88,174,929 F257I possibly damaging Het
Olfr231 C T 1: 174,117,204 V271I probably benign Het
Olfr273 T C 4: 52,855,764 I250V probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pdzd2 A C 15: 12,419,481 M501R possibly damaging Het
Pitx1 T C 13: 55,828,652 K65E probably benign Het
Pla1a C T 16: 38,409,610 A247T probably benign Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Prss8 A G 7: 127,929,807 S26P probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Rock2 T A 12: 16,977,683 C1334S probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Serpina6 A G 12: 103,646,887 W385R probably damaging Het
Slc12a5 T C 2: 164,979,343 M249T probably benign Het
Srsf9 T A 5: 115,332,592 I117N probably damaging Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc21a T C 9: 119,941,280 V139A probably benign Het
Zfp236 A T 18: 82,630,000 V1012D probably damaging Het
Zfp612 C A 8: 110,089,297 Q379K probably damaging Het
Zfp930 C T 8: 69,228,246 Q198* probably null Het
Other mutations in Irgm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Irgm1 APN 11 48866005 nonsense probably null
IGL01821:Irgm1 APN 11 48866526 missense probably damaging 1.00
IGL02043:Irgm1 APN 11 48866815 missense probably damaging 0.98
IGL02252:Irgm1 APN 11 48866154 missense possibly damaging 0.92
IGL03153:Irgm1 APN 11 48866267 missense probably damaging 1.00
igraine UTSW 11 48866613 missense probably benign 0.33
R0487:Irgm1 UTSW 11 48866327 missense probably damaging 0.98
R1808:Irgm1 UTSW 11 48866432 missense probably damaging 0.99
R1809:Irgm1 UTSW 11 48866613 missense probably benign 0.33
R1878:Irgm1 UTSW 11 48866070 missense probably benign 0.07
R2971:Irgm1 UTSW 11 48866590 nonsense probably null
R4962:Irgm1 UTSW 11 48866332 missense possibly damaging 0.93
R5186:Irgm1 UTSW 11 48866217 missense probably benign 0.00
R5794:Irgm1 UTSW 11 48866237 missense probably damaging 0.99
R6224:Irgm1 UTSW 11 48866886 missense probably benign 0.02
R6487:Irgm1 UTSW 11 48865950 missense probably benign 0.21
R6752:Irgm1 UTSW 11 48866463 missense probably damaging 1.00
R6766:Irgm1 UTSW 11 48866101 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TACGCATGGGAGAAATCTCAAC -3'
(R):5'- TGACTTCCCGAAGCTTAGGG -3'

Sequencing Primer
(F):5'- CGGAAGAATGCATTCACAATTGC -3'
(R):5'- GCTTAGGGACACACTTCATAAAG -3'
Posted On2015-07-21