Incidental Mutation 'R0069:Prox1'
ID33082
Institutional Source Beutler Lab
Gene Symbol Prox1
Ensembl Gene ENSMUSG00000010175
Gene Nameprospero homeobox 1
SynonymsA230003G05Rik
MMRRC Submission 038360-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0069 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location190118035-190170714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 190160919 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 443 (V443A)
Ref Sequence ENSEMBL: ENSMUSP00000135066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010319] [ENSMUST00000175916] [ENSMUST00000177288]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010319
AA Change: V443A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000010319
Gene: ENSMUSG00000010175
AA Change: V443A

DomainStartEndE-ValueType
low complexity region 208 223 N/A INTRINSIC
SCOP:d1fxkc_ 227 363 9e-5 SMART
low complexity region 514 526 N/A INTRINSIC
low complexity region 529 545 N/A INTRINSIC
Pfam:HPD 578 735 8.9e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000175916
AA Change: V443A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135703
Gene: ENSMUSG00000010175
AA Change: V443A

DomainStartEndE-ValueType
low complexity region 208 223 N/A INTRINSIC
SCOP:d1fxkc_ 227 363 9e-5 SMART
low complexity region 514 526 N/A INTRINSIC
low complexity region 529 545 N/A INTRINSIC
Pfam:HPD 578 735 8.9e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177288
AA Change: V443A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135066
Gene: ENSMUSG00000010175
AA Change: V443A

DomainStartEndE-ValueType
low complexity region 208 223 N/A INTRINSIC
SCOP:d1fxkc_ 227 363 9e-5 SMART
low complexity region 514 526 N/A INTRINSIC
low complexity region 529 545 N/A INTRINSIC
Pfam:HPD 579 732 2.2e-86 PFAM
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the homeobox transcription factor family. Members of this family contain a homeobox domain that consists of a 60-amino acid helix-turn-helix structure that binds DNA and RNA. The protein encoded by this gene is conserved across vertebrates and may play an essential role during development. Altered levels of this protein have been reported in cancers of different organs, such as colon, brain, blood, breast, pancreas, liver and esophagus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality with impaired development of the lens, lymphatic system, liver and pancreas. Heterozygous mutation results in early postnatal lethality with varying penetrance on different genetic backgrounds, obesity and lymphatic vessel abnormalities [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,561,562 C632S probably damaging Het
Antxr2 T A 5: 97,948,250 M392L possibly damaging Het
Cd101 A G 3: 101,008,217 V678A probably benign Het
Clec2g T A 6: 128,948,753 S42T probably benign Het
Clec2g T C 6: 128,980,311 probably null Het
Creb1 A G 1: 64,576,208 I240V possibly damaging Het
D2hgdh G T 1: 93,835,287 V265L possibly damaging Het
Dctn2 A T 10: 127,277,485 probably null Het
Diablo A T 5: 123,518,024 S117R probably damaging Het
Ebf2 A T 14: 67,410,050 R349S probably damaging Het
Fam168a C T 7: 100,835,411 A252V probably benign Het
Fbn2 T C 18: 58,069,184 Y1299C probably damaging Het
Gne A C 4: 44,060,099 V98G probably damaging Het
Hk2 A G 6: 82,736,528 probably null Het
Ifi206 A T 1: 173,486,847 V9D probably damaging Het
Ints3 A G 3: 90,400,647 probably benign Het
Itgal A G 7: 127,310,331 T56A probably benign Het
Lzts3 T A 2: 130,636,540 T213S probably benign Het
Map1b A G 13: 99,429,848 S2122P unknown Het
Mei4 C T 9: 82,025,582 Q223* probably null Het
Mpzl3 T C 9: 45,068,252 V167A probably damaging Het
Myo1d A G 11: 80,637,953 I681T probably damaging Het
Myom2 A G 8: 15,117,624 T1070A probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Nfx1 T C 4: 40,986,688 probably benign Het
Olfr1335 A T 4: 118,809,690 V58D probably damaging Het
Olfr952 A G 9: 39,426,892 Y60H probably damaging Het
Ostm1 A C 10: 42,692,956 D37A probably benign Het
Pde8a T C 7: 81,319,123 probably benign Het
Pole2 A T 12: 69,209,887 V288E probably damaging Het
Poteg T C 8: 27,447,821 S2P probably benign Het
Ppp2r5c A T 12: 110,567,770 M356L probably benign Het
Prkdc G A 16: 15,726,504 S1786N probably benign Het
Prpf6 T A 2: 181,615,963 probably null Het
Ptger1 A T 8: 83,668,319 T142S possibly damaging Het
Rad54l2 C A 9: 106,710,365 V734L possibly damaging Het
Rnpepl1 T A 1: 92,918,898 N507K possibly damaging Het
Slc38a10 A T 11: 120,106,502 V722E probably damaging Het
Slfn10-ps A G 11: 83,035,542 noncoding transcript Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sult1e1 A T 5: 87,579,897 H175Q probably damaging Het
Ube2e3 C A 2: 78,919,949 probably benign Het
Vmn1r208 A T 13: 22,772,425 W301R probably benign Het
Vps13d A G 4: 145,062,563 I746T probably benign Het
Xpnpep3 T C 15: 81,430,798 V233A probably benign Het
Zfp329 A T 7: 12,810,932 S222T probably damaging Het
Zswim6 T C 13: 107,738,563 noncoding transcript Het
Other mutations in Prox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Prox1 APN 1 190123410 splice site probably benign
IGL01729:Prox1 APN 1 190161175 missense probably benign
IGL02167:Prox1 APN 1 190161280 missense probably benign 0.13
IGL02416:Prox1 APN 1 190161130 missense probably benign 0.00
IGL02419:Prox1 APN 1 190161130 missense probably benign 0.00
IGL03234:Prox1 APN 1 190161636 missense probably damaging 1.00
R0514:Prox1 UTSW 1 190161456 missense probably damaging 0.99
R1249:Prox1 UTSW 1 190147061 missense possibly damaging 0.94
R1299:Prox1 UTSW 1 190146943 splice site probably benign
R1601:Prox1 UTSW 1 190161006 missense probably damaging 0.99
R1893:Prox1 UTSW 1 190160518 splice site probably benign
R2090:Prox1 UTSW 1 190160812 missense probably damaging 0.99
R2366:Prox1 UTSW 1 190161882 missense probably damaging 0.96
R4614:Prox1 UTSW 1 190162008 missense probably damaging 0.99
R4799:Prox1 UTSW 1 190153472 missense probably damaging 0.98
R4873:Prox1 UTSW 1 190162122 missense probably damaging 0.99
R4875:Prox1 UTSW 1 190162122 missense probably damaging 0.99
R5124:Prox1 UTSW 1 190161279 missense possibly damaging 0.73
R5149:Prox1 UTSW 1 190147053 missense possibly damaging 0.89
R5256:Prox1 UTSW 1 190161441 missense probably benign 0.02
R5545:Prox1 UTSW 1 190147142 missense probably damaging 1.00
R5985:Prox1 UTSW 1 190146955 missense possibly damaging 0.93
R5993:Prox1 UTSW 1 190162239 missense probably damaging 1.00
R6833:Prox1 UTSW 1 190160778 missense probably damaging 0.99
R7335:Prox1 UTSW 1 190161845 missense possibly damaging 0.93
R7385:Prox1 UTSW 1 190162126 missense probably benign
Z1088:Prox1 UTSW 1 190161999 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTTGTTGTGTCCCGAGTCAAGTC -3'
(R):5'- GGTCAAAGTCTTCTCAGCCAAACCC -3'

Sequencing Primer
(F):5'- TGTCCCGAGTCAAGTCTAAGG -3'
(R):5'- AAACCCTCTCGCCAGGTTC -3'
Posted On2013-05-09