Incidental Mutation 'R4493:Pold1'
ID330832
Institutional Source Beutler Lab
Gene Symbol Pold1
Ensembl Gene ENSMUSG00000038644
Gene Namepolymerase (DNA directed), delta 1, catalytic subunit
Synonyms125kDa
MMRRC Submission 041748-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R4493 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44532746-44548849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44537708 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 683 (V683A)
Ref Sequence ENSEMBL: ENSMUSP00000039776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049343] [ENSMUST00000145956] [ENSMUST00000151793]
Predicted Effect probably damaging
Transcript: ENSMUST00000049343
AA Change: V683A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039776
Gene: ENSMUSG00000038644
AA Change: V683A

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 2.53e-161 SMART
Blast:POLBc 790 837 1e-18 BLAST
Pfam:zf-C4pol 1010 1080 5.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141742
Predicted Effect probably benign
Transcript: ENSMUST00000145956
SMART Domains Protein: ENSMUSP00000117844
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 2e-8 BLAST
PDB:3IAY|A 76 151 7e-8 PDB
SCOP:d1tgoa1 117 153 3e-10 SMART
Blast:POLBc 130 153 7e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147503
Predicted Effect probably damaging
Transcript: ENSMUST00000151793
AA Change: V683A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117157
Gene: ENSMUSG00000038644
AA Change: V683A

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 66 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 7.8e-164 SMART
Blast:POLBc 790 837 1e-18 BLAST
low complexity region 914 938 N/A INTRINSIC
low complexity region 959 980 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184044
Meta Mutation Damage Score 0.33 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have an elevated mutation rate as well as an increased incidence of tumors. Median age for these mice is around 10 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1b T C 2: 24,652,938 T1301A probably damaging Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Ccdc146 T C 5: 21,303,193 E619G possibly damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cngb3 C A 4: 19,367,778 P229Q probably damaging Het
Ctnna2 A G 6: 76,981,848 V461A probably damaging Het
D430041D05Rik T C 2: 104,256,339 D764G probably benign Het
Dgki T C 6: 36,974,861 probably benign Het
Dhx36 A T 3: 62,488,504 probably benign Het
Gcn1l1 T C 5: 115,594,144 I1006T probably benign Het
Glt8d2 T A 10: 82,664,713 M20L possibly damaging Het
Greb1 C A 12: 16,698,610 G1122V probably benign Het
Hmcn1 A T 1: 150,701,899 I2037N probably damaging Het
Hspa4l A G 3: 40,768,002 I340V possibly damaging Het
Itpr3 A G 17: 27,104,612 K1204E probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Maats1 T C 16: 38,341,768 T4A probably benign Het
Mcph1 T A 8: 18,631,736 C296* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Naga A G 15: 82,332,514 F259S probably damaging Het
Nes A G 3: 87,976,813 E793G probably damaging Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Pcdha4 A T 18: 36,954,591 Y609F possibly damaging Het
Pgam1 C T 19: 41,915,776 A104V possibly damaging Het
Piezo2 T C 18: 63,114,063 I525V probably damaging Het
Poteg T C 8: 27,480,097 V316A possibly damaging Het
Ppih A T 4: 119,310,845 N156K probably damaging Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rtp4 A T 16: 23,610,077 H30L probably benign Het
Stkld1 A G 2: 26,946,626 N268S probably benign Het
Syt6 A G 3: 103,585,630 E66G probably damaging Het
Tas2r129 A G 6: 132,951,354 I85V probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tprn T C 2: 25,268,892 S643P probably damaging Het
Trrap T C 5: 144,831,048 V2605A probably benign Het
Vmn1r230 T A 17: 20,846,601 N17K probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp946 T A 17: 22,451,086 probably null Het
Other mutations in Pold1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Pold1 APN 7 44543232 splice site probably benign
IGL01626:Pold1 APN 7 44533372 critical splice donor site probably null
IGL01635:Pold1 APN 7 44535977 missense probably damaging 1.00
IGL02165:Pold1 APN 7 44538060 missense probably damaging 1.00
IGL02197:Pold1 APN 7 44542239 missense probably benign 0.07
IGL02579:Pold1 APN 7 44543279 missense probably damaging 1.00
IGL03104:Pold1 APN 7 44540580 missense probably damaging 1.00
IGL03118:Pold1 APN 7 44539400 missense probably benign 0.17
PIT4243001:Pold1 UTSW 7 44542158 missense possibly damaging 0.77
PIT4431001:Pold1 UTSW 7 44538894 missense probably damaging 1.00
R0184:Pold1 UTSW 7 44541715 missense probably benign 0.32
R0266:Pold1 UTSW 7 44541025 splice site probably benign
R0537:Pold1 UTSW 7 44535092 missense probably damaging 1.00
R1251:Pold1 UTSW 7 44535051 missense probably benign 0.02
R1348:Pold1 UTSW 7 44534682 missense probably benign 0.00
R1376:Pold1 UTSW 7 44540562 missense probably damaging 1.00
R1376:Pold1 UTSW 7 44540562 missense probably damaging 1.00
R1445:Pold1 UTSW 7 44542757 splice site probably benign
R2156:Pold1 UTSW 7 44539118 missense probably damaging 1.00
R2256:Pold1 UTSW 7 44533799 critical splice acceptor site probably null
R2259:Pold1 UTSW 7 44541484 splice site probably benign
R2870:Pold1 UTSW 7 44543347 synonymous silent
R3793:Pold1 UTSW 7 44541570 missense probably damaging 1.00
R4583:Pold1 UTSW 7 44538913 missense probably damaging 0.97
R4661:Pold1 UTSW 7 44532809 missense probably damaging 0.99
R4738:Pold1 UTSW 7 44541329 missense probably damaging 0.99
R4769:Pold1 UTSW 7 44535071 missense probably damaging 1.00
R4797:Pold1 UTSW 7 44541901 missense possibly damaging 0.91
R5009:Pold1 UTSW 7 44533902 missense probably benign 0.13
R5150:Pold1 UTSW 7 44535832 missense possibly damaging 0.91
R5534:Pold1 UTSW 7 44538619 missense probably damaging 1.00
R5988:Pold1 UTSW 7 44540580 missense probably damaging 1.00
R6113:Pold1 UTSW 7 44537700 missense probably damaging 1.00
R6127:Pold1 UTSW 7 44542121 missense probably damaging 1.00
R6232:Pold1 UTSW 7 44540842 critical splice donor site probably null
R6435:Pold1 UTSW 7 44538778 missense probably damaging 1.00
R6436:Pold1 UTSW 7 44538778 missense probably damaging 1.00
R6437:Pold1 UTSW 7 44538778 missense probably damaging 1.00
R6930:Pold1 UTSW 7 44542206 missense probably benign
R7049:Pold1 UTSW 7 44541371 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAGCATGATCTGACATCTGTGG -3'
(R):5'- TTTCCAGGTGTTACCCCGTG -3'

Sequencing Primer
(F):5'- ATGATCTGACATCTGTGGCTCCTG -3'
(R):5'- TGTTACCCCGTGCCTGGTG -3'
Posted On2015-07-21