Incidental Mutation 'R4493:Pcdha4'
ID330850
Institutional Source Beutler Lab
Gene Symbol Pcdha4
Ensembl Gene ENSMUSG00000104252
Gene Nameprotocadherin alpha 4
SynonymsCnr1, Crnr1
MMRRC Submission 041748-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R4493 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location36952648-37187661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36954591 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 609 (Y609F)
Ref Sequence ENSEMBL: ENSMUSP00000141408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192295] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000193839] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115661
AA Change: Y609F

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458
AA Change: Y609F

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192512
AA Change: Y609F

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252
AA Change: Y609F

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194235
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1b T C 2: 24,652,938 T1301A probably damaging Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Ccdc146 T C 5: 21,303,193 E619G possibly damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cngb3 C A 4: 19,367,778 P229Q probably damaging Het
Ctnna2 A G 6: 76,981,848 V461A probably damaging Het
D430041D05Rik T C 2: 104,256,339 D764G probably benign Het
Dgki T C 6: 36,974,861 probably benign Het
Dhx36 A T 3: 62,488,504 probably benign Het
Gcn1l1 T C 5: 115,594,144 I1006T probably benign Het
Glt8d2 T A 10: 82,664,713 M20L possibly damaging Het
Greb1 C A 12: 16,698,610 G1122V probably benign Het
Hmcn1 A T 1: 150,701,899 I2037N probably damaging Het
Hspa4l A G 3: 40,768,002 I340V possibly damaging Het
Itpr3 A G 17: 27,104,612 K1204E probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Maats1 T C 16: 38,341,768 T4A probably benign Het
Mcph1 T A 8: 18,631,736 C296* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Naga A G 15: 82,332,514 F259S probably damaging Het
Nes A G 3: 87,976,813 E793G probably damaging Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Pgam1 C T 19: 41,915,776 A104V possibly damaging Het
Piezo2 T C 18: 63,114,063 I525V probably damaging Het
Pold1 A G 7: 44,537,708 V683A probably damaging Het
Poteg T C 8: 27,480,097 V316A possibly damaging Het
Ppih A T 4: 119,310,845 N156K probably damaging Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rtp4 A T 16: 23,610,077 H30L probably benign Het
Stkld1 A G 2: 26,946,626 N268S probably benign Het
Syt6 A G 3: 103,585,630 E66G probably damaging Het
Tas2r129 A G 6: 132,951,354 I85V probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tprn T C 2: 25,268,892 S643P probably damaging Het
Trrap T C 5: 144,831,048 V2605A probably benign Het
Vmn1r230 T A 17: 20,846,601 N17K probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp946 T A 17: 22,451,086 probably null Het
Other mutations in Pcdha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2570:Pcdha4 UTSW 18 36953612 missense probably benign 0.00
R3114:Pcdha4 UTSW 18 36953550 missense probably benign 0.02
R3115:Pcdha4 UTSW 18 36953550 missense probably benign 0.02
R4154:Pcdha4 UTSW 18 36953586 intron probably null
R4381:Pcdha4 UTSW 18 36952875 missense probably damaging 1.00
R4389:Pcdha4 UTSW 18 36954789 missense probably benign
R4801:Pcdha4 UTSW 18 36953955 nonsense probably null
R4802:Pcdha4 UTSW 18 36953955 nonsense probably null
R4827:Pcdha4 UTSW 18 36953198 missense probably damaging 1.00
R4928:Pcdha4 UTSW 18 36954816 missense probably benign 0.01
R5001:Pcdha4 UTSW 18 36954948 missense probably benign
R5330:Pcdha4 UTSW 18 36954702 missense probably benign 0.01
R5331:Pcdha4 UTSW 18 36954702 missense probably benign 0.01
R5540:Pcdha4 UTSW 18 36954837 missense probably benign 0.01
R5587:Pcdha4 UTSW 18 36954822 missense probably benign
R5931:Pcdha4 UTSW 18 36954755 missense probably damaging 1.00
R6249:Pcdha4 UTSW 18 36953676 missense probably damaging 0.99
R6427:Pcdha4 UTSW 18 36953733 missense probably benign 0.00
R6612:Pcdha4 UTSW 18 36954978 missense probably benign 0.00
R6616:Pcdha4 UTSW 18 36953900 missense probably benign
R7030:Pcdha4 UTSW 18 36954027 missense probably damaging 1.00
R7198:Pcdha4 UTSW 18 36953560 missense probably damaging 0.99
R7411:Pcdha4 UTSW 18 36953058 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAATGTGACTCTGCAGGTG -3'
(R):5'- TACTCGCGATGGAGCCTTTG -3'

Sequencing Primer
(F):5'- GTTTGTGCTGGACGAGAATGACAAC -3'
(R):5'- CGATGGAGCCTTTGGTACC -3'
Posted On2015-07-21