Incidental Mutation 'R0069:Sult1e1'
ID33091
Institutional Source Beutler Lab
Gene Symbol Sult1e1
Ensembl Gene ENSMUSG00000029272
Gene Namesulfotransferase family 1E, member 1
SynonymsEST, Ste
MMRRC Submission 038360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R0069 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location87575969-87591594 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87579897 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 175 (H175Q)
Ref Sequence ENSEMBL: ENSMUSP00000031201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031201]
Predicted Effect probably damaging
Transcript: ENSMUST00000031201
AA Change: H175Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031201
Gene: ENSMUSG00000029272
AA Change: H175Q

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 38 288 1.1e-91 PFAM
Meta Mutation Damage Score 0.458 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a protein that transfers a sulfo moiety to and from estrone, which may control levels of estrogen receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced fertility. Males exhibit abnormal testis morphology with Leydig cell hypertrophy and hyperplasia and reduced caudal sperm motility. Spontaneous fetal loss caused by placental thrombosis occurs in pregnant females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,561,562 C632S probably damaging Het
Antxr2 T A 5: 97,948,250 M392L possibly damaging Het
Cd101 A G 3: 101,008,217 V678A probably benign Het
Clec2g T A 6: 128,948,753 S42T probably benign Het
Clec2g T C 6: 128,980,311 probably null Het
Creb1 A G 1: 64,576,208 I240V possibly damaging Het
D2hgdh G T 1: 93,835,287 V265L possibly damaging Het
Dctn2 A T 10: 127,277,485 probably null Het
Diablo A T 5: 123,518,024 S117R probably damaging Het
Ebf2 A T 14: 67,410,050 R349S probably damaging Het
Fam168a C T 7: 100,835,411 A252V probably benign Het
Fbn2 T C 18: 58,069,184 Y1299C probably damaging Het
Gne A C 4: 44,060,099 V98G probably damaging Het
Hk2 A G 6: 82,736,528 probably null Het
Ifi206 A T 1: 173,486,847 V9D probably damaging Het
Ints3 A G 3: 90,400,647 probably benign Het
Itgal A G 7: 127,310,331 T56A probably benign Het
Lzts3 T A 2: 130,636,540 T213S probably benign Het
Map1b A G 13: 99,429,848 S2122P unknown Het
Mei4 C T 9: 82,025,582 Q223* probably null Het
Mpzl3 T C 9: 45,068,252 V167A probably damaging Het
Myo1d A G 11: 80,637,953 I681T probably damaging Het
Myom2 A G 8: 15,117,624 T1070A probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Nfx1 T C 4: 40,986,688 probably benign Het
Olfr1335 A T 4: 118,809,690 V58D probably damaging Het
Olfr952 A G 9: 39,426,892 Y60H probably damaging Het
Ostm1 A C 10: 42,692,956 D37A probably benign Het
Pde8a T C 7: 81,319,123 probably benign Het
Pole2 A T 12: 69,209,887 V288E probably damaging Het
Poteg T C 8: 27,447,821 S2P probably benign Het
Ppp2r5c A T 12: 110,567,770 M356L probably benign Het
Prkdc G A 16: 15,726,504 S1786N probably benign Het
Prox1 A G 1: 190,160,919 V443A possibly damaging Het
Prpf6 T A 2: 181,615,963 probably null Het
Ptger1 A T 8: 83,668,319 T142S possibly damaging Het
Rad54l2 C A 9: 106,710,365 V734L possibly damaging Het
Rnpepl1 T A 1: 92,918,898 N507K possibly damaging Het
Slc38a10 A T 11: 120,106,502 V722E probably damaging Het
Slfn10-ps A G 11: 83,035,542 noncoding transcript Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Ube2e3 C A 2: 78,919,949 probably benign Het
Vmn1r208 A T 13: 22,772,425 W301R probably benign Het
Vps13d A G 4: 145,062,563 I746T probably benign Het
Xpnpep3 T C 15: 81,430,798 V233A probably benign Het
Zfp329 A T 7: 12,810,932 S222T probably damaging Het
Zswim6 T C 13: 107,738,563 noncoding transcript Het
Other mutations in Sult1e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01504:Sult1e1 APN 5 87576301 missense probably damaging 1.00
IGL01588:Sult1e1 APN 5 87576243 missense probably benign 0.01
IGL02685:Sult1e1 APN 5 87579906 nonsense probably null
IGL03083:Sult1e1 APN 5 87590124 missense probably benign
IGL03137:Sult1e1 APN 5 87578616 missense probably benign 0.00
IGL03217:Sult1e1 APN 5 87590088 missense possibly damaging 0.46
R0069:Sult1e1 UTSW 5 87579897 missense probably damaging 1.00
R0456:Sult1e1 UTSW 5 87578634 missense possibly damaging 0.86
R1446:Sult1e1 UTSW 5 87578537 missense probably damaging 1.00
R1953:Sult1e1 UTSW 5 87587671 critical splice acceptor site probably null
R2697:Sult1e1 UTSW 5 87578538 missense probably damaging 1.00
R4791:Sult1e1 UTSW 5 87586730 missense possibly damaging 0.61
R4799:Sult1e1 UTSW 5 87590168 missense possibly damaging 0.70
R5103:Sult1e1 UTSW 5 87576232 missense probably benign
R5158:Sult1e1 UTSW 5 87587594 missense probably damaging 1.00
R5219:Sult1e1 UTSW 5 87578586 missense probably damaging 0.98
R6148:Sult1e1 UTSW 5 87579911 missense probably damaging 1.00
R6530:Sult1e1 UTSW 5 87576288 missense probably benign 0.18
R6866:Sult1e1 UTSW 5 87586766 missense probably damaging 1.00
R7295:Sult1e1 UTSW 5 87578653 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTCTGCAACAGGTTGTTGTTAGG -3'
(R):5'- CCTTGTCTCTGTCTCACACAAACAGAA -3'

Sequencing Primer
(F):5'- GGTTTCCAGTGATAATATTGCATCC -3'
(R):5'- cacacacactcacacacac -3'
Posted On2013-05-09