Mutagenetix > Incidental Mutation

Incidental Mutation 'R0069:Diablo'

33093

Institutional Source

Beutler Lab

Gene Symbol

Diablo

Ensembl Gene

ENSMUSG00000029433

Gene Name

diablo, IAP-binding mitochondrial protein

Synonyms

0610041G12Rik, 1700006L01Rik, Smac

MMRRC Submission

038360-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0069 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

123647828-123662239 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 123656087 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 117 (S117R)

Ref Sequence

ENSEMBL: ENSMUSP00000031385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031385] [ENSMUST00000111586] [ENSMUST00000111587] [ENSMUST00000125652] [ENSMUST00000139398] [ENSMUST00000145152] [ENSMUST00000200247] [ENSMUST00000197682]

AlphaFold

Q9JIQ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000031385
AA Change: S117R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031385
Gene: ENSMUSG00000029433
AA Change: S117R

Domain	Start	End	E-Value	Type
Pfam:Smac_DIABLO	6	174	6e-86	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111586
AA Change: S117R

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107213
Gene: ENSMUSG00000029433
AA Change: S117R

Domain	Start	End	E-Value	Type
Pfam:Smac_DIABLO	6	174	7.6e-85	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111587
AA Change: S117R

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107214
Gene: ENSMUSG00000029433
AA Change: S117R

Domain	Start	End	E-Value	Type
Pfam:Smac_DIABLO	9	237	4.1e-106	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125047

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125652
AA Change: S117R

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000115045
Gene: ENSMUSG00000029433
AA Change: S117R

Domain	Start	End	E-Value	Type
Pfam:Smac_DIABLO	6	237	1.1e-111	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134552

Predicted Effect

possibly damaging
Transcript: ENSMUST00000139398
AA Change: S117R

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000143485
Gene: ENSMUSG00000029433
AA Change: S117R

Domain	Start	End	E-Value	Type
Pfam:Smac_DIABLO	6	150	7.1e-68	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000145152
AA Change: S117R

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000143617
Gene: ENSMUSG00000029433
AA Change: S117R

Domain	Start	End	E-Value	Type
Pfam:Smac_DIABLO	9	150	3.4e-62	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000200247
AA Change: S68R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000143673
Gene: ENSMUSG00000029433
AA Change: S68R

Domain	Start	End	E-Value	Type
Pfam:Smac_DIABLO	1	109	4.4e-57	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149334

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158764

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183364

Predicted Effect

probably benign
Transcript: ENSMUST00000197682

Meta Mutation Damage Score

0.1244

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.4%

Validation Efficiency

96% (52/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes are viable and fertile with no gross morphological or histological abnormalities. Normal induction of apoptosis in UV-irradiated or Fas-antibody treated cells was noted, and these mice also exhibit normal T and B cell proliferative responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	T	6: 128,538,525 (GRCm39)	C632S	probably damaging	Het
Antxr2	T	A	5: 98,096,109 (GRCm39)	M392L	possibly damaging	Het
Cd101	A	G	3: 100,915,533 (GRCm39)	V678A	probably benign	Het
Clec2g	T	C	6: 128,957,274 (GRCm39)		probably null	Het
Clec2g	T	A	6: 128,925,716 (GRCm39)	S42T	probably benign	Het
Creb1	A	G	1: 64,615,367 (GRCm39)	I240V	possibly damaging	Het
D2hgdh	G	T	1: 93,763,009 (GRCm39)	V265L	possibly damaging	Het
Dctn2	A	T	10: 127,113,354 (GRCm39)		probably null	Het
Ebf2	A	T	14: 67,647,499 (GRCm39)	R349S	probably damaging	Het
Fam168a	C	T	7: 100,484,618 (GRCm39)	A252V	probably benign	Het
Fbn2	T	C	18: 58,202,256 (GRCm39)	Y1299C	probably damaging	Het
Gne	A	C	4: 44,060,099 (GRCm39)	V98G	probably damaging	Het
Hk2	A	G	6: 82,713,509 (GRCm39)		probably null	Het
Ifi206	A	T	1: 173,314,413 (GRCm39)	V9D	probably damaging	Het
Ints3	A	G	3: 90,307,954 (GRCm39)		probably benign	Het
Itgal	A	G	7: 126,909,503 (GRCm39)	T56A	probably benign	Het
Lzts3	T	A	2: 130,478,460 (GRCm39)	T213S	probably benign	Het
Map1b	A	G	13: 99,566,356 (GRCm39)	S2122P	unknown	Het
Mei4	C	T	9: 81,907,635 (GRCm39)	Q223*	probably null	Het
Mpzl3	T	C	9: 44,979,550 (GRCm39)	V167A	probably damaging	Het
Myo1d	A	G	11: 80,528,779 (GRCm39)	I681T	probably damaging	Het
Myom2	A	G	8: 15,167,624 (GRCm39)	T1070A	probably benign	Het
Nacc1	T	A	8: 85,403,828 (GRCm39)	I16F	probably damaging	Het
Nfx1	T	C	4: 40,986,688 (GRCm39)		probably benign	Het
Or10ak12	A	T	4: 118,666,887 (GRCm39)	V58D	probably damaging	Het
Or8g33	A	G	9: 39,338,188 (GRCm39)	Y60H	probably damaging	Het
Ostm1	A	C	10: 42,568,952 (GRCm39)	D37A	probably benign	Het
Pde8a	T	C	7: 80,968,871 (GRCm39)		probably benign	Het
Pole2	A	T	12: 69,256,661 (GRCm39)	V288E	probably damaging	Het
Poteg	T	C	8: 27,937,849 (GRCm39)	S2P	probably benign	Het
Ppp2r5c	A	T	12: 110,534,204 (GRCm39)	M356L	probably benign	Het
Prkdc	G	A	16: 15,544,368 (GRCm39)	S1786N	probably benign	Het
Prox1	A	G	1: 189,893,116 (GRCm39)	V443A	possibly damaging	Het
Prpf6	T	A	2: 181,257,756 (GRCm39)		probably null	Het
Ptger1	A	T	8: 84,394,948 (GRCm39)	T142S	possibly damaging	Het
Rad54l2	C	A	9: 106,587,564 (GRCm39)	V734L	possibly damaging	Het
Rnpepl1	T	A	1: 92,846,620 (GRCm39)	N507K	possibly damaging	Het
Slc38a10	A	T	11: 119,997,328 (GRCm39)	V722E	probably damaging	Het
Slfn10-ps	A	G	11: 82,926,368 (GRCm39)		noncoding transcript	Het
Slitrk6	A	T	14: 110,987,364 (GRCm39)	L781H	probably damaging	Het
Sult1e1	A	T	5: 87,727,756 (GRCm39)	H175Q	probably damaging	Het
Ube2e3	C	A	2: 78,750,293 (GRCm39)		probably benign	Het
Vmn1r208	A	T	13: 22,956,595 (GRCm39)	W301R	probably benign	Het
Vps13d	A	G	4: 144,789,133 (GRCm39)	I746T	probably benign	Het
Xpnpep3	T	C	15: 81,314,999 (GRCm39)	V233A	probably benign	Het
Zfp329	A	T	7: 12,544,859 (GRCm39)	S222T	probably damaging	Het
Zswim6	T	C	13: 107,875,098 (GRCm39)		noncoding transcript	Het

Other mutations in Diablo

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00826:Diablo	APN	5	123,650,751 (GRCm39)	missense	probably benign	0.01
R0069:Diablo	UTSW	5	123,656,087 (GRCm39)	missense	probably damaging	0.96
R2141:Diablo	UTSW	5	123,661,424 (GRCm39)	missense	probably benign	0.01
R8447:Diablo	UTSW	5	123,655,829 (GRCm39)	missense	probably damaging	1.00
R8777:Diablo	UTSW	5	123,655,990 (GRCm39)	missense	unknown
R8777-TAIL:Diablo	UTSW	5	123,655,990 (GRCm39)	missense	unknown
R9567:Diablo	UTSW	5	123,662,196 (GRCm39)	unclassified	probably benign
R9779:Diablo	UTSW	5	123,662,132 (GRCm39)	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCTGTCATCCAAGTGGTCTCCAAC -3'
(R):5'- ATGACCATGATCTGCATGACACCC -3'

Sequencing Primer
(F):5'- TCATCTGCAAGTTTAGAAGAGAGC -3'
(R):5'- gtcttgaacttgaaatcctcctg -3'

Posted On

2013-05-09