Incidental Mutation 'R4496:Gtf3c3'
ID330956
Institutional Source Beutler Lab
Gene Symbol Gtf3c3
Ensembl Gene ENSMUSG00000041303
Gene Namegeneral transcription factor IIIC, polypeptide 3
Synonyms
MMRRC Submission 041749-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R4496 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location54396004-54438971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 54424132 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 302 (S302R)
Ref Sequence ENSEMBL: ENSMUSP00000039420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041638]
Predicted Effect probably benign
Transcript: ENSMUST00000041638
AA Change: S302R

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000039420
Gene: ENSMUSG00000041303
AA Change: S302R

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
low complexity region 92 108 N/A INTRINSIC
TPR 145 178 9.24e1 SMART
TPR 179 212 2.36e1 SMART
TPR 213 246 4.58e-4 SMART
TPR 247 280 6.4e1 SMART
Blast:TPR 286 319 6e-9 BLAST
low complexity region 353 365 N/A INTRINSIC
TPR 452 485 1.87e1 SMART
low complexity region 549 560 N/A INTRINSIC
TPR 807 840 3.27e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190419
Meta Mutation Damage Score 0.1268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the TFIIIC2 complex, which binds to the promoters of small nuclear and cytoplasmic RNA genes in order to recruit RNA polymerase III. The TFIIIC2 complex is composed of six subunits. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,383,973 L514H possibly damaging Het
Abca7 T C 10: 80,002,934 F647S probably damaging Het
Ahi1 A G 10: 20,965,545 K244E probably benign Het
Ankhd1 G A 18: 36,560,786 D17N probably damaging Het
Arvcf G T 16: 18,405,182 K890N probably damaging Het
Atp11c T C X: 60,280,744 D478G probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Clca2 C T 3: 145,092,165 D180N possibly damaging Het
Comt T C 16: 18,411,687 probably null Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cyp2d11 C T 15: 82,391,948 probably benign Het
D10Jhu81e T C 10: 78,163,543 I145V probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fam169b G T 7: 68,358,206 C289F possibly damaging Het
Fam214a T A 9: 75,031,531 S1038T probably damaging Het
Fastkd5 T C 2: 130,616,581 T30A probably benign Het
Fchsd2 A C 7: 101,282,495 T753P probably benign Het
Glis3 G A 19: 28,666,127 S5L possibly damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Gpt A T 15: 76,698,463 Q276L probably damaging Het
Hnrnpc A G 14: 52,075,431 S229P probably benign Het
Ikzf5 T C 7: 131,396,664 probably null Het
Mal2 T C 15: 54,598,439 V110A probably damaging Het
Myo3b A G 2: 70,254,404 D702G probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nat10 T A 2: 103,757,739 I14F probably damaging Het
Nat14 C T 7: 4,923,919 T30M probably damaging Het
Ndst4 C A 3: 125,683,273 A49D probably damaging Het
Nnt A T 13: 119,381,765 M292K probably damaging Het
Obox7 C T 7: 14,665,374 T175I probably benign Het
Olfr1395 T A 11: 49,148,387 N43K possibly damaging Het
Olfr787 T G 10: 129,463,561 V295G possibly damaging Het
Plekhm3 T C 1: 64,861,236 E634G probably damaging Het
Plxdc2 T A 2: 16,512,229 I107K probably damaging Het
Psmb10 T A 8: 105,936,028 R226S probably damaging Het
Ptprr T A 10: 116,229,502 V160E possibly damaging Het
Sema5a T A 15: 32,640,987 L649H probably damaging Het
Sephs1 T A 2: 4,906,683 I356K probably benign Het
Serpinb3d C T 1: 107,079,292 V229M probably damaging Het
Slc7a4 T C 16: 17,575,812 D41G probably damaging Het
Sort1 T C 3: 108,310,145 V121A probably benign Het
Tcf20 C A 15: 82,854,984 Q755H probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttll13 A T 7: 80,256,919 Y445F probably benign Het
Usp40 T C 1: 87,995,737 I271V possibly damaging Het
Vmn1r72 A G 7: 11,669,864 I219T probably damaging Het
Other mutations in Gtf3c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Gtf3c3 APN 1 54415955 missense probably damaging 0.99
IGL00435:Gtf3c3 APN 1 54427535 missense possibly damaging 0.73
IGL01128:Gtf3c3 APN 1 54428876 missense possibly damaging 0.91
R0243:Gtf3c3 UTSW 1 54403536 missense possibly damaging 0.60
R0271:Gtf3c3 UTSW 1 54428812 missense possibly damaging 0.96
R0571:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0965:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0968:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1069:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1070:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1111:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1112:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1113:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1114:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1115:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1117:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1118:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1119:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1228:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1230:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1231:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1382:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1394:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1395:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1397:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1414:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1430:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1432:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1473:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1497:Gtf3c3 UTSW 1 54437939 missense probably benign
R1556:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1563:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1638:Gtf3c3 UTSW 1 54405119 missense probably damaging 1.00
R1695:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1716:Gtf3c3 UTSW 1 54399260 missense probably damaging 1.00
R1745:Gtf3c3 UTSW 1 54434212 missense probably damaging 1.00
R1767:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1799:Gtf3c3 UTSW 1 54420424 missense possibly damaging 0.82
R1861:Gtf3c3 UTSW 1 54438838 missense possibly damaging 0.87
R1940:Gtf3c3 UTSW 1 54428958 splice site probably benign
R3804:Gtf3c3 UTSW 1 54424007 critical splice donor site probably null
R4621:Gtf3c3 UTSW 1 54419416 missense probably damaging 1.00
R5131:Gtf3c3 UTSW 1 54419498 synonymous probably null
R5320:Gtf3c3 UTSW 1 54405873 missense probably damaging 1.00
R5605:Gtf3c3 UTSW 1 54415926 missense probably benign 0.06
R5854:Gtf3c3 UTSW 1 54419437 missense probably benign 0.01
R6050:Gtf3c3 UTSW 1 54406070 missense probably benign 0.00
R6441:Gtf3c3 UTSW 1 54406038 missense probably benign 0.03
R6892:Gtf3c3 UTSW 1 54415941 missense probably benign 0.00
R7114:Gtf3c3 UTSW 1 54423507 missense probably benign
R7299:Gtf3c3 UTSW 1 54417708 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTCTGGAAGACAAGCACAGG -3'
(R):5'- GAACCTTCTCTGCTGGCATCAAC -3'

Sequencing Primer
(F):5'- CTGGAAGACAAGCACAGGTTTATATC -3'
(R):5'- ACCTGGTGCCAGCCTATCAC -3'
Posted On2015-07-21