Incidental Mutation 'R4496:Plekhm3'
ID330957
Institutional Source Beutler Lab
Gene Symbol Plekhm3
Ensembl Gene ENSMUSG00000051344
Gene Namepleckstrin homology domain containing, family M, member 3
Synonyms9430067K14Rik, A230102O09Rik, Plekhm1l
MMRRC Submission 041749-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R4496 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location64785983-64956824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64861236 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 634 (E634G)
Ref Sequence ENSEMBL: ENSMUSP00000138002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097713] [ENSMUST00000139649]
Predicted Effect probably damaging
Transcript: ENSMUST00000097713
AA Change: E634G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095320
Gene: ENSMUSG00000051344
AA Change: E634G

DomainStartEndE-ValueType
low complexity region 184 195 N/A INTRINSIC
PH 213 311 4.86e-3 SMART
PH 362 458 7.88e-12 SMART
low complexity region 489 503 N/A INTRINSIC
DUF4206 529 732 2.73e-114 SMART
C1 670 722 3.9e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139649
AA Change: E634G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138002
Gene: ENSMUSG00000051344
AA Change: E634G

DomainStartEndE-ValueType
low complexity region 184 195 N/A INTRINSIC
PH 213 311 4.86e-3 SMART
PH 362 458 7.88e-12 SMART
low complexity region 489 503 N/A INTRINSIC
DUF4206 529 732 2.73e-114 SMART
C1 670 722 3.9e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140857
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,383,973 L514H possibly damaging Het
Abca7 T C 10: 80,002,934 F647S probably damaging Het
Ahi1 A G 10: 20,965,545 K244E probably benign Het
Ankhd1 G A 18: 36,560,786 D17N probably damaging Het
Arvcf G T 16: 18,405,182 K890N probably damaging Het
Atp11c T C X: 60,280,744 D478G probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Clca2 C T 3: 145,092,165 D180N possibly damaging Het
Comt T C 16: 18,411,687 probably null Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cyp2d11 C T 15: 82,391,948 probably benign Het
D10Jhu81e T C 10: 78,163,543 I145V probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fam169b G T 7: 68,358,206 C289F possibly damaging Het
Fam214a T A 9: 75,031,531 S1038T probably damaging Het
Fastkd5 T C 2: 130,616,581 T30A probably benign Het
Fchsd2 A C 7: 101,282,495 T753P probably benign Het
Glis3 G A 19: 28,666,127 S5L possibly damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Gpt A T 15: 76,698,463 Q276L probably damaging Het
Gtf3c3 G T 1: 54,424,132 S302R probably benign Het
Hnrnpc A G 14: 52,075,431 S229P probably benign Het
Ikzf5 T C 7: 131,396,664 probably null Het
Mal2 T C 15: 54,598,439 V110A probably damaging Het
Myo3b A G 2: 70,254,404 D702G probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nat10 T A 2: 103,757,739 I14F probably damaging Het
Nat14 C T 7: 4,923,919 T30M probably damaging Het
Ndst4 C A 3: 125,683,273 A49D probably damaging Het
Nnt A T 13: 119,381,765 M292K probably damaging Het
Obox7 C T 7: 14,665,374 T175I probably benign Het
Olfr1395 T A 11: 49,148,387 N43K possibly damaging Het
Olfr787 T G 10: 129,463,561 V295G possibly damaging Het
Plxdc2 T A 2: 16,512,229 I107K probably damaging Het
Psmb10 T A 8: 105,936,028 R226S probably damaging Het
Ptprr T A 10: 116,229,502 V160E possibly damaging Het
Sema5a T A 15: 32,640,987 L649H probably damaging Het
Sephs1 T A 2: 4,906,683 I356K probably benign Het
Serpinb3d C T 1: 107,079,292 V229M probably damaging Het
Slc7a4 T C 16: 17,575,812 D41G probably damaging Het
Sort1 T C 3: 108,310,145 V121A probably benign Het
Tcf20 C A 15: 82,854,984 Q755H probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttll13 A T 7: 80,256,919 Y445F probably benign Het
Usp40 T C 1: 87,995,737 I271V possibly damaging Het
Vmn1r72 A G 7: 11,669,864 I219T probably damaging Het
Other mutations in Plekhm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Plekhm3 APN 1 64921832 missense probably damaging 1.00
IGL01732:Plekhm3 APN 1 64922248 missense probably benign 0.44
IGL02422:Plekhm3 APN 1 64921866 nonsense probably null
IGL02724:Plekhm3 APN 1 64795117 missense probably damaging 0.97
IGL03226:Plekhm3 APN 1 64921800 missense possibly damaging 0.58
IGL03250:Plekhm3 APN 1 64938047 missense possibly damaging 0.65
R0124:Plekhm3 UTSW 1 64921751 missense probably damaging 0.99
R1336:Plekhm3 UTSW 1 64937781 small deletion probably benign
R1467:Plekhm3 UTSW 1 64892882 missense probably damaging 1.00
R1467:Plekhm3 UTSW 1 64892882 missense probably damaging 1.00
R1560:Plekhm3 UTSW 1 64937817 missense probably benign 0.03
R1901:Plekhm3 UTSW 1 64937781 small deletion probably benign
R2328:Plekhm3 UTSW 1 64937781 small deletion probably benign
R2432:Plekhm3 UTSW 1 64937856 missense probably damaging 1.00
R2568:Plekhm3 UTSW 1 64937781 small deletion probably benign
R3023:Plekhm3 UTSW 1 64937781 small deletion probably benign
R4529:Plekhm3 UTSW 1 64937825 missense probably benign 0.14
R4682:Plekhm3 UTSW 1 64937927 missense possibly damaging 0.94
R4969:Plekhm3 UTSW 1 64937919 missense probably damaging 1.00
R5347:Plekhm3 UTSW 1 64819990 missense probably damaging 1.00
R5553:Plekhm3 UTSW 1 64921886 missense possibly damaging 0.89
R5583:Plekhm3 UTSW 1 64937986 nonsense probably null
R5953:Plekhm3 UTSW 1 64937895 missense probably damaging 0.98
R6319:Plekhm3 UTSW 1 64921934 missense probably benign 0.20
R6970:Plekhm3 UTSW 1 64892753 missense possibly damaging 0.80
R7014:Plekhm3 UTSW 1 64883270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGTAGTTGGGAGCAGAATC -3'
(R):5'- CATACCTAGGATGAGAAGCCAG -3'

Sequencing Primer
(F):5'- GCTGCTAAACTCTGTCCAAAGTGG -3'
(R):5'- TTTCGAGTTCAAGGCCACAG -3'
Posted On2015-07-21