Incidental Mutation 'R4496:Usp40'
ID330958
Institutional Source Beutler Lab
Gene Symbol Usp40
Ensembl Gene ENSMUSG00000005501
Gene Nameubiquitin specific peptidase 40
SynonymsB230215L03Rik
MMRRC Submission 041749-MU
Accession Numbers

Genbank: NM_001033291

Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4496 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87945119-88008551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87995737 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 271 (I271V)
Ref Sequence ENSEMBL: ENSMUSP00000140107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040783] [ENSMUST00000187758] [ENSMUST00000188332]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040783
AA Change: I271V

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038533
Gene: ENSMUSG00000005501
AA Change: I271V

DomainStartEndE-ValueType
Pfam:UCH 40 344 1.1e-31 PFAM
Pfam:UCH_1 41 320 1.2e-20 PFAM
low complexity region 641 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186315
Predicted Effect possibly damaging
Transcript: ENSMUST00000187758
AA Change: I271V

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140107
Gene: ENSMUSG00000005501
AA Change: I271V

DomainStartEndE-ValueType
Pfam:UCH 40 346 8.7e-41 PFAM
Pfam:UCH_1 41 319 2.4e-22 PFAM
low complexity region 641 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188332
SMART Domains Protein: ENSMUSP00000140574
Gene: ENSMUSG00000005501

DomainStartEndE-ValueType
Pfam:UCH 40 70 5.9e-6 PFAM
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP40 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,383,973 L514H possibly damaging Het
Abca7 T C 10: 80,002,934 F647S probably damaging Het
Ahi1 A G 10: 20,965,545 K244E probably benign Het
Ankhd1 G A 18: 36,560,786 D17N probably damaging Het
Arvcf G T 16: 18,405,182 K890N probably damaging Het
Atp11c T C X: 60,280,744 D478G probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Clca2 C T 3: 145,092,165 D180N possibly damaging Het
Comt T C 16: 18,411,687 probably null Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cyp2d11 C T 15: 82,391,948 probably benign Het
D10Jhu81e T C 10: 78,163,543 I145V probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fam169b G T 7: 68,358,206 C289F possibly damaging Het
Fam214a T A 9: 75,031,531 S1038T probably damaging Het
Fastkd5 T C 2: 130,616,581 T30A probably benign Het
Fchsd2 A C 7: 101,282,495 T753P probably benign Het
Glis3 G A 19: 28,666,127 S5L possibly damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Gpt A T 15: 76,698,463 Q276L probably damaging Het
Gtf3c3 G T 1: 54,424,132 S302R probably benign Het
Hnrnpc A G 14: 52,075,431 S229P probably benign Het
Ikzf5 T C 7: 131,396,664 probably null Het
Mal2 T C 15: 54,598,439 V110A probably damaging Het
Myo3b A G 2: 70,254,404 D702G probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nat10 T A 2: 103,757,739 I14F probably damaging Het
Nat14 C T 7: 4,923,919 T30M probably damaging Het
Ndst4 C A 3: 125,683,273 A49D probably damaging Het
Nnt A T 13: 119,381,765 M292K probably damaging Het
Obox7 C T 7: 14,665,374 T175I probably benign Het
Olfr1395 T A 11: 49,148,387 N43K possibly damaging Het
Olfr787 T G 10: 129,463,561 V295G possibly damaging Het
Plekhm3 T C 1: 64,861,236 E634G probably damaging Het
Plxdc2 T A 2: 16,512,229 I107K probably damaging Het
Psmb10 T A 8: 105,936,028 R226S probably damaging Het
Ptprr T A 10: 116,229,502 V160E possibly damaging Het
Sema5a T A 15: 32,640,987 L649H probably damaging Het
Sephs1 T A 2: 4,906,683 I356K probably benign Het
Serpinb3d C T 1: 107,079,292 V229M probably damaging Het
Slc7a4 T C 16: 17,575,812 D41G probably damaging Het
Sort1 T C 3: 108,310,145 V121A probably benign Het
Tcf20 C A 15: 82,854,984 Q755H probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttll13 A T 7: 80,256,919 Y445F probably benign Het
Vmn1r72 A G 7: 11,669,864 I219T probably damaging Het
Other mutations in Usp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Usp40 APN 1 88004238 splice site probably benign
IGL00828:Usp40 APN 1 87978306 unclassified probably benign
IGL01090:Usp40 APN 1 87962465 missense probably benign 0.01
IGL01123:Usp40 APN 1 87986123 missense probably benign 0.01
IGL01401:Usp40 APN 1 87994198 missense probably damaging 1.00
IGL02506:Usp40 APN 1 87982016 missense probably damaging 0.98
IGL02580:Usp40 APN 1 87980966 splice site probably null
IGL02625:Usp40 APN 1 87950017 missense probably benign 0.19
IGL02811:Usp40 APN 1 87995736 missense probably damaging 1.00
IGL02958:Usp40 APN 1 87978485 missense probably damaging 0.99
G5030:Usp40 UTSW 1 87994219 missense probably damaging 1.00
R0019:Usp40 UTSW 1 87978411 missense probably benign 0.00
R0282:Usp40 UTSW 1 87980958 splice site probably benign
R0453:Usp40 UTSW 1 87946598 makesense probably null
R0646:Usp40 UTSW 1 87978522 missense probably benign 0.00
R1440:Usp40 UTSW 1 87982086 missense probably benign 0.01
R1490:Usp40 UTSW 1 87988965 nonsense probably null
R1620:Usp40 UTSW 1 87994225 missense probably damaging 1.00
R1881:Usp40 UTSW 1 87994271 missense probably benign 0.08
R1903:Usp40 UTSW 1 87982056 missense probably benign 0.15
R1912:Usp40 UTSW 1 87946646 missense probably benign 0.00
R1919:Usp40 UTSW 1 87995842 missense possibly damaging 0.75
R1976:Usp40 UTSW 1 87978536 missense probably benign 0.00
R2111:Usp40 UTSW 1 87950214 missense probably benign 0.17
R2112:Usp40 UTSW 1 87950214 missense probably benign 0.17
R2163:Usp40 UTSW 1 87995858 splice site probably benign
R2432:Usp40 UTSW 1 87982082 missense probably benign
R2865:Usp40 UTSW 1 87949979 nonsense probably null
R3885:Usp40 UTSW 1 87967269 missense probably damaging 1.00
R4360:Usp40 UTSW 1 87952361 missense probably damaging 1.00
R4370:Usp40 UTSW 1 87997875 missense probably benign
R4714:Usp40 UTSW 1 87967179 splice site probably null
R4888:Usp40 UTSW 1 87986201 critical splice acceptor site probably null
R4944:Usp40 UTSW 1 87952355 missense probably benign 0.10
R5269:Usp40 UTSW 1 87995782 missense probably benign 0.01
R5629:Usp40 UTSW 1 87981009 missense probably benign
R5696:Usp40 UTSW 1 87995752 missense probably benign 0.27
R5756:Usp40 UTSW 1 87951691 missense possibly damaging 0.66
R5887:Usp40 UTSW 1 87999870 missense probably damaging 1.00
R5910:Usp40 UTSW 1 87968400 nonsense probably null
R6014:Usp40 UTSW 1 87980016 missense probably damaging 1.00
R6044:Usp40 UTSW 1 87990150 missense probably benign
R6083:Usp40 UTSW 1 87978559 missense probably benign 0.01
R6299:Usp40 UTSW 1 87997927 missense probably damaging 0.99
R6625:Usp40 UTSW 1 87967213 missense probably benign 0.01
R6757:Usp40 UTSW 1 87980037 missense probably damaging 0.99
R6810:Usp40 UTSW 1 87981033 missense probably benign 0.11
R7110:Usp40 UTSW 1 87986162 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CACACAGCAACTTTCTTGGG -3'
(R):5'- ACAGCAAAGCATTATGTATTCTGTC -3'

Sequencing Primer
(F):5'- GGTACCACAGGCCTTAATCTTAG -3'
(R):5'- CTGTCATGTAACTTTGTCAATTCTTC -3'
Posted On2015-07-21