Incidental Mutation 'R4496:Clca2'
ID330969
Institutional Source Beutler Lab
Gene Symbol Clca2
Ensembl Gene ENSMUSG00000036960
Gene Namechloride channel accessory 2
SynonymsClca5
MMRRC Submission 041749-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4496 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location145070263-145099443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 145092165 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 180 (D180N)
Ref Sequence ENSEMBL: ENSMUSP00000143161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040465] [ENSMUST00000198993]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040465
AA Change: D180N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036029
Gene: ENSMUSG00000036960
AA Change: D180N

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
VWA 309 485 3.55e-5 SMART
low complexity region 739 754 N/A INTRINSIC
Blast:FN3 765 875 5e-21 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000198993
AA Change: D180N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143161
Gene: ENSMUSG00000036960
AA Change: D180N

DomainStartEndE-ValueType
Pfam:CLCA_N 7 265 1.7e-121 PFAM
VWA 309 485 2.2e-7 SMART
Pfam:DUF1973 494 674 7.8e-75 PFAM
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a member of the calcium-activated chloride channel regulator (CLCR) family of proteins. Members of this family regulate the transport of chloride across the plasma membrane. Expression of this gene is upregulated by the tumor suppressor protein p53 in response to DNA damage. Mice lacking a functional copy of this gene exhibit increased liver weight and hepatocyte hypertrophy. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit increases in liver weight to body weight ratio and hepatocyte hypertrophy; one incidence of multifocal hepatic necrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,383,973 L514H possibly damaging Het
Abca7 T C 10: 80,002,934 F647S probably damaging Het
Ahi1 A G 10: 20,965,545 K244E probably benign Het
Ankhd1 G A 18: 36,560,786 D17N probably damaging Het
Arvcf G T 16: 18,405,182 K890N probably damaging Het
Atp11c T C X: 60,280,744 D478G probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Comt T C 16: 18,411,687 probably null Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cyp2d11 C T 15: 82,391,948 probably benign Het
D10Jhu81e T C 10: 78,163,543 I145V probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fam169b G T 7: 68,358,206 C289F possibly damaging Het
Fam214a T A 9: 75,031,531 S1038T probably damaging Het
Fastkd5 T C 2: 130,616,581 T30A probably benign Het
Fchsd2 A C 7: 101,282,495 T753P probably benign Het
Glis3 G A 19: 28,666,127 S5L possibly damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Gpt A T 15: 76,698,463 Q276L probably damaging Het
Gtf3c3 G T 1: 54,424,132 S302R probably benign Het
Hnrnpc A G 14: 52,075,431 S229P probably benign Het
Ikzf5 T C 7: 131,396,664 probably null Het
Mal2 T C 15: 54,598,439 V110A probably damaging Het
Myo3b A G 2: 70,254,404 D702G probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nat10 T A 2: 103,757,739 I14F probably damaging Het
Nat14 C T 7: 4,923,919 T30M probably damaging Het
Ndst4 C A 3: 125,683,273 A49D probably damaging Het
Nnt A T 13: 119,381,765 M292K probably damaging Het
Obox7 C T 7: 14,665,374 T175I probably benign Het
Olfr1395 T A 11: 49,148,387 N43K possibly damaging Het
Olfr787 T G 10: 129,463,561 V295G possibly damaging Het
Plekhm3 T C 1: 64,861,236 E634G probably damaging Het
Plxdc2 T A 2: 16,512,229 I107K probably damaging Het
Psmb10 T A 8: 105,936,028 R226S probably damaging Het
Ptprr T A 10: 116,229,502 V160E possibly damaging Het
Sema5a T A 15: 32,640,987 L649H probably damaging Het
Sephs1 T A 2: 4,906,683 I356K probably benign Het
Serpinb3d C T 1: 107,079,292 V229M probably damaging Het
Slc7a4 T C 16: 17,575,812 D41G probably damaging Het
Sort1 T C 3: 108,310,145 V121A probably benign Het
Tcf20 C A 15: 82,854,984 Q755H probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttll13 A T 7: 80,256,919 Y445F probably benign Het
Usp40 T C 1: 87,995,737 I271V possibly damaging Het
Vmn1r72 A G 7: 11,669,864 I219T probably damaging Het
Other mutations in Clca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Clca2 APN 3 145098813 missense probably damaging 1.00
IGL01337:Clca2 APN 3 145095178 missense probably damaging 1.00
IGL01389:Clca2 APN 3 145077868 critical splice donor site probably null
IGL01595:Clca2 APN 3 145088007 missense probably damaging 1.00
IGL01704:Clca2 APN 3 145095218 missense probably benign 0.04
IGL02416:Clca2 APN 3 145085016 missense probably benign 0.02
IGL02455:Clca2 APN 3 145081411 missense probably benign 0.00
IGL02481:Clca2 APN 3 145084940 missense possibly damaging 0.92
IGL02526:Clca2 APN 3 145088018 missense probably benign 0.02
IGL02797:Clca2 APN 3 145081263 missense probably benign 0.02
IGL03253:Clca2 APN 3 145071563 missense probably benign 0.41
IGL03256:Clca2 APN 3 145086392 missense possibly damaging 0.75
IGL03294:Clca2 APN 3 145097769 missense probably damaging 1.00
3370:Clca2 UTSW 3 145077977 missense probably damaging 1.00
R0479:Clca2 UTSW 3 145090849 missense probably damaging 1.00
R0542:Clca2 UTSW 3 145075810 splice site probably benign
R0629:Clca2 UTSW 3 145072239 missense probably benign
R1488:Clca2 UTSW 3 145084164 missense possibly damaging 0.49
R1523:Clca2 UTSW 3 145071644 nonsense probably null
R1568:Clca2 UTSW 3 145075649 nonsense probably null
R1650:Clca2 UTSW 3 145092212 missense probably damaging 1.00
R1771:Clca2 UTSW 3 145081410 missense probably benign 0.12
R2101:Clca2 UTSW 3 145077938 missense probably damaging 0.99
R2242:Clca2 UTSW 3 145090790 missense probably damaging 0.98
R3751:Clca2 UTSW 3 145071455 missense probably benign 0.04
R4962:Clca2 UTSW 3 145077879 missense probably damaging 1.00
R5344:Clca2 UTSW 3 145087942 missense probably damaging 1.00
R5424:Clca2 UTSW 3 145084181 missense probably damaging 0.99
R5931:Clca2 UTSW 3 145092125 missense possibly damaging 0.88
R6181:Clca2 UTSW 3 145090708 nonsense probably null
R6598:Clca2 UTSW 3 145086485 nonsense probably null
R7167:Clca2 UTSW 3 145097784 missense probably benign 0.40
R7229:Clca2 UTSW 3 145084108 missense probably damaging 1.00
R7256:Clca2 UTSW 3 145090847 missense probably damaging 0.99
X0025:Clca2 UTSW 3 145086504 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGAATTTTCTCCTTGCTATATGGGC -3'
(R):5'- TCTCTGATGGTAGGAGACGAGG -3'

Sequencing Primer
(F):5'- TGTGGACAAAGCTGACCTTG -3'
(R):5'- TGGGGAGAGAAGTAACCCAAATTTC -3'
Posted On2015-07-21