Incidental Mutation 'R4496:Fam169b'
ID330975
Institutional Source Beutler Lab
Gene Symbol Fam169b
Ensembl Gene ENSMUSG00000074071
Gene Namefamily with sequence similarity 169, member B
SynonymsEG434197
MMRRC Submission 041749-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R4496 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location68273839-68363092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 68358206 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 289 (C289F)
Ref Sequence ENSEMBL: ENSMUSP00000147610 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000098378
AA Change: C283F

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000125685
AA Change: C284F

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153805
Predicted Effect possibly damaging
Transcript: ENSMUST00000210558
AA Change: C289F

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.0484 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,383,973 L514H possibly damaging Het
Abca7 T C 10: 80,002,934 F647S probably damaging Het
Ahi1 A G 10: 20,965,545 K244E probably benign Het
Ankhd1 G A 18: 36,560,786 D17N probably damaging Het
Arvcf G T 16: 18,405,182 K890N probably damaging Het
Atp11c T C X: 60,280,744 D478G probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Clca2 C T 3: 145,092,165 D180N possibly damaging Het
Comt T C 16: 18,411,687 probably null Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cyp2d11 C T 15: 82,391,948 probably benign Het
D10Jhu81e T C 10: 78,163,543 I145V probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fam214a T A 9: 75,031,531 S1038T probably damaging Het
Fastkd5 T C 2: 130,616,581 T30A probably benign Het
Fchsd2 A C 7: 101,282,495 T753P probably benign Het
Glis3 G A 19: 28,666,127 S5L possibly damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Gpt A T 15: 76,698,463 Q276L probably damaging Het
Gtf3c3 G T 1: 54,424,132 S302R probably benign Het
Hnrnpc A G 14: 52,075,431 S229P probably benign Het
Ikzf5 T C 7: 131,396,664 probably null Het
Mal2 T C 15: 54,598,439 V110A probably damaging Het
Myo3b A G 2: 70,254,404 D702G probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nat10 T A 2: 103,757,739 I14F probably damaging Het
Nat14 C T 7: 4,923,919 T30M probably damaging Het
Ndst4 C A 3: 125,683,273 A49D probably damaging Het
Nnt A T 13: 119,381,765 M292K probably damaging Het
Obox7 C T 7: 14,665,374 T175I probably benign Het
Olfr1395 T A 11: 49,148,387 N43K possibly damaging Het
Olfr787 T G 10: 129,463,561 V295G possibly damaging Het
Plekhm3 T C 1: 64,861,236 E634G probably damaging Het
Plxdc2 T A 2: 16,512,229 I107K probably damaging Het
Psmb10 T A 8: 105,936,028 R226S probably damaging Het
Ptprr T A 10: 116,229,502 V160E possibly damaging Het
Sema5a T A 15: 32,640,987 L649H probably damaging Het
Sephs1 T A 2: 4,906,683 I356K probably benign Het
Serpinb3d C T 1: 107,079,292 V229M probably damaging Het
Slc7a4 T C 16: 17,575,812 D41G probably damaging Het
Sort1 T C 3: 108,310,145 V121A probably benign Het
Tcf20 C A 15: 82,854,984 Q755H probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttll13 A T 7: 80,256,919 Y445F probably benign Het
Usp40 T C 1: 87,995,737 I271V possibly damaging Het
Vmn1r72 A G 7: 11,669,864 I219T probably damaging Het
Other mutations in Fam169b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3735:Fam169b UTSW 7 68350301 missense probably damaging 1.00
R5373:Fam169b UTSW 7 68300838 missense probably damaging 1.00
R5500:Fam169b UTSW 7 68350369 missense probably damaging 0.99
R6480:Fam169b UTSW 7 68353718 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGCTGAGCTACATCCCCAC -3'
(R):5'- TATGGTCCACTGCTAGGGAG -3'

Sequencing Primer
(F):5'- GCTACATCCCCACCACTGAATTG -3'
(R):5'- TAGAGCCCAGGTGTCCAAG -3'
Posted On2015-07-21