Incidental Mutation 'R4496:Fchsd2'
ID330977
Institutional Source Beutler Lab
Gene Symbol Fchsd2
Ensembl Gene ENSMUSG00000030691
Gene NameFCH and double SH3 domains 2
SynonymsSh3md3
MMRRC Submission 041749-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R4496 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101092863-101284405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 101282495 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 753 (T753P)
Ref Sequence ENSEMBL: ENSMUSP00000032931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032931] [ENSMUST00000098250] [ENSMUST00000120267] [ENSMUST00000207740]
Predicted Effect probably benign
Transcript: ENSMUST00000032931
AA Change: T753P

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032931
Gene: ENSMUSG00000030691
AA Change: T753P

DomainStartEndE-ValueType
Pfam:FCH 21 103 1.3e-22 PFAM
coiled coil region 379 421 N/A INTRINSIC
low complexity region 466 474 N/A INTRINSIC
SH3 496 553 2.39e-14 SMART
low complexity region 554 569 N/A INTRINSIC
SH3 594 652 1.22e-20 SMART
low complexity region 676 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098250
AA Change: T729P

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000095850
Gene: ENSMUSG00000030691
AA Change: T729P

DomainStartEndE-ValueType
Pfam:FCH 12 108 3.6e-23 PFAM
coiled coil region 355 397 N/A INTRINSIC
low complexity region 442 450 N/A INTRINSIC
SH3 472 529 2.39e-14 SMART
low complexity region 530 545 N/A INTRINSIC
SH3 570 628 1.22e-20 SMART
low complexity region 652 671 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120267
SMART Domains Protein: ENSMUSP00000112500
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 20 211 2.3e-36 PFAM
WD40 329 368 1.13e-7 SMART
WD40 373 412 6.79e-2 SMART
WD40 415 454 1.08e-4 SMART
WD40 457 493 2.97e0 SMART
WD40 496 534 1.61e-3 SMART
WD40 539 580 1.66e0 SMART
WD40 583 623 2.8e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207740
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,383,973 L514H possibly damaging Het
Abca7 T C 10: 80,002,934 F647S probably damaging Het
Ahi1 A G 10: 20,965,545 K244E probably benign Het
Ankhd1 G A 18: 36,560,786 D17N probably damaging Het
Arvcf G T 16: 18,405,182 K890N probably damaging Het
Atp11c T C X: 60,280,744 D478G probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Clca2 C T 3: 145,092,165 D180N possibly damaging Het
Comt T C 16: 18,411,687 probably null Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cyp2d11 C T 15: 82,391,948 probably benign Het
D10Jhu81e T C 10: 78,163,543 I145V probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fam169b G T 7: 68,358,206 C289F possibly damaging Het
Fam214a T A 9: 75,031,531 S1038T probably damaging Het
Fastkd5 T C 2: 130,616,581 T30A probably benign Het
Glis3 G A 19: 28,666,127 S5L possibly damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Gpt A T 15: 76,698,463 Q276L probably damaging Het
Gtf3c3 G T 1: 54,424,132 S302R probably benign Het
Hnrnpc A G 14: 52,075,431 S229P probably benign Het
Ikzf5 T C 7: 131,396,664 probably null Het
Mal2 T C 15: 54,598,439 V110A probably damaging Het
Myo3b A G 2: 70,254,404 D702G probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nat10 T A 2: 103,757,739 I14F probably damaging Het
Nat14 C T 7: 4,923,919 T30M probably damaging Het
Ndst4 C A 3: 125,683,273 A49D probably damaging Het
Nnt A T 13: 119,381,765 M292K probably damaging Het
Obox7 C T 7: 14,665,374 T175I probably benign Het
Olfr1395 T A 11: 49,148,387 N43K possibly damaging Het
Olfr787 T G 10: 129,463,561 V295G possibly damaging Het
Plekhm3 T C 1: 64,861,236 E634G probably damaging Het
Plxdc2 T A 2: 16,512,229 I107K probably damaging Het
Psmb10 T A 8: 105,936,028 R226S probably damaging Het
Ptprr T A 10: 116,229,502 V160E possibly damaging Het
Sema5a T A 15: 32,640,987 L649H probably damaging Het
Sephs1 T A 2: 4,906,683 I356K probably benign Het
Serpinb3d C T 1: 107,079,292 V229M probably damaging Het
Slc7a4 T C 16: 17,575,812 D41G probably damaging Het
Sort1 T C 3: 108,310,145 V121A probably benign Het
Tcf20 C A 15: 82,854,984 Q755H probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttll13 A T 7: 80,256,919 Y445F probably benign Het
Usp40 T C 1: 87,995,737 I271V possibly damaging Het
Vmn1r72 A G 7: 11,669,864 I219T probably damaging Het
Other mutations in Fchsd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Fchsd2 APN 7 101271622 missense probably benign 0.26
IGL00910:Fchsd2 APN 7 101277626 missense probably benign 0.00
IGL02065:Fchsd2 APN 7 101177222 critical splice donor site probably null
IGL02545:Fchsd2 APN 7 101198508 missense probably benign
IGL02651:Fchsd2 APN 7 101277600 missense possibly damaging 0.60
IGL03286:Fchsd2 APN 7 101259775 critical splice donor site probably null
IGL03333:Fchsd2 APN 7 101198496 missense probably damaging 0.97
R0066:Fchsd2 UTSW 7 101278424 missense possibly damaging 0.60
R0066:Fchsd2 UTSW 7 101278424 missense possibly damaging 0.60
R0668:Fchsd2 UTSW 7 101196920 missense possibly damaging 0.63
R1281:Fchsd2 UTSW 7 101253552 missense possibly damaging 0.92
R1868:Fchsd2 UTSW 7 101250438 splice site probably benign
R1996:Fchsd2 UTSW 7 101278453 missense probably benign 0.00
R2024:Fchsd2 UTSW 7 101198533 missense possibly damaging 0.81
R2060:Fchsd2 UTSW 7 101277417 missense probably benign
R2243:Fchsd2 UTSW 7 101233885 missense probably benign 0.30
R3419:Fchsd2 UTSW 7 101278660 splice site probably null
R3898:Fchsd2 UTSW 7 101191799 missense possibly damaging 0.90
R3899:Fchsd2 UTSW 7 101191799 missense possibly damaging 0.90
R3900:Fchsd2 UTSW 7 101191799 missense possibly damaging 0.90
R4569:Fchsd2 UTSW 7 101277602 missense possibly damaging 0.60
R4667:Fchsd2 UTSW 7 101250449 missense probably damaging 1.00
R5408:Fchsd2 UTSW 7 101271574 missense possibly damaging 0.82
R5449:Fchsd2 UTSW 7 101277524 missense probably damaging 1.00
R5543:Fchsd2 UTSW 7 101271699 missense probably damaging 1.00
R5665:Fchsd2 UTSW 7 101110784 missense possibly damaging 0.50
R5894:Fchsd2 UTSW 7 101191752 missense probably benign 0.08
R5936:Fchsd2 UTSW 7 101191701 missense probably damaging 1.00
R6243:Fchsd2 UTSW 7 101271809 critical splice acceptor site probably benign
R6244:Fchsd2 UTSW 7 101259776 splice site probably null
R6247:Fchsd2 UTSW 7 101253540 missense probably benign
R6932:Fchsd2 UTSW 7 101277414 nonsense probably null
R7250:Fchsd2 UTSW 7 101259685 missense possibly damaging 0.61
X0028:Fchsd2 UTSW 7 101110804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCAGTGAACACATTCCC -3'
(R):5'- ACCCGCTATGATTTGTGCTATGG -3'

Sequencing Primer
(F):5'- GTGAACACATTCCCAGGCC -3'
(R):5'- TGTGCTATGGTAGGAGAGATGAC -3'
Posted On2015-07-21