Incidental Mutation 'R4496:Ptprr'
ID330984
Institutional Source Beutler Lab
Gene Symbol Ptprr
Ensembl Gene ENSMUSG00000020151
Gene Nameprotein tyrosine phosphatase, receptor type, R
SynonymsPTPBR7, PTP-SL, RPTPRR
MMRRC Submission 041749-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R4496 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location116018213-116274932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116229502 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 160 (V160E)
Ref Sequence ENSEMBL: ENSMUSP00000122259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063470] [ENSMUST00000105271] [ENSMUST00000128399] [ENSMUST00000148731] [ENSMUST00000155606]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063470
AA Change: V404E

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064392
Gene: ENSMUSG00000020151
AA Change: V404E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
PTPc 391 648 3.74e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105271
AA Change: V297E

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000100907
Gene: ENSMUSG00000020151
AA Change: V297E

DomainStartEndE-ValueType
transmembrane domain 119 141 N/A INTRINSIC
PTPc 284 541 3.74e-108 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124369
Predicted Effect possibly damaging
Transcript: ENSMUST00000128399
AA Change: V160E

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114455
Gene: ENSMUSG00000020151
AA Change: V160E

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000148731
AA Change: V160E

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120965
Gene: ENSMUSG00000020151
AA Change: V160E

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000155606
AA Change: V160E

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122259
Gene: ENSMUSG00000020151
AA Change: V160E

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Meta Mutation Damage Score 0.0944 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracellular catalytic domain, and thus represents a receptor-type PTP. Silencing of this gene has been associated with colorectal cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares a symbol (PTPRQ) with another gene, protein tyrosine phosphatase, receptor type, Q (GeneID 374462), which is also located on chromosome 12. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased ERK1/2 phosphorylation levels in cerebellar Purkinje cells, decreased grip strength, and ataxia characterized by fine motor coordination and balance defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,383,973 L514H possibly damaging Het
Abca7 T C 10: 80,002,934 F647S probably damaging Het
Ahi1 A G 10: 20,965,545 K244E probably benign Het
Ankhd1 G A 18: 36,560,786 D17N probably damaging Het
Arvcf G T 16: 18,405,182 K890N probably damaging Het
Atp11c T C X: 60,280,744 D478G probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Clca2 C T 3: 145,092,165 D180N possibly damaging Het
Comt T C 16: 18,411,687 probably null Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cyp2d11 C T 15: 82,391,948 probably benign Het
D10Jhu81e T C 10: 78,163,543 I145V probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fam169b G T 7: 68,358,206 C289F possibly damaging Het
Fam214a T A 9: 75,031,531 S1038T probably damaging Het
Fastkd5 T C 2: 130,616,581 T30A probably benign Het
Fchsd2 A C 7: 101,282,495 T753P probably benign Het
Glis3 G A 19: 28,666,127 S5L possibly damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Gpt A T 15: 76,698,463 Q276L probably damaging Het
Gtf3c3 G T 1: 54,424,132 S302R probably benign Het
Hnrnpc A G 14: 52,075,431 S229P probably benign Het
Ikzf5 T C 7: 131,396,664 probably null Het
Mal2 T C 15: 54,598,439 V110A probably damaging Het
Myo3b A G 2: 70,254,404 D702G probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nat10 T A 2: 103,757,739 I14F probably damaging Het
Nat14 C T 7: 4,923,919 T30M probably damaging Het
Ndst4 C A 3: 125,683,273 A49D probably damaging Het
Nnt A T 13: 119,381,765 M292K probably damaging Het
Obox7 C T 7: 14,665,374 T175I probably benign Het
Olfr1395 T A 11: 49,148,387 N43K possibly damaging Het
Olfr787 T G 10: 129,463,561 V295G possibly damaging Het
Plekhm3 T C 1: 64,861,236 E634G probably damaging Het
Plxdc2 T A 2: 16,512,229 I107K probably damaging Het
Psmb10 T A 8: 105,936,028 R226S probably damaging Het
Sema5a T A 15: 32,640,987 L649H probably damaging Het
Sephs1 T A 2: 4,906,683 I356K probably benign Het
Serpinb3d C T 1: 107,079,292 V229M probably damaging Het
Slc7a4 T C 16: 17,575,812 D41G probably damaging Het
Sort1 T C 3: 108,310,145 V121A probably benign Het
Tcf20 C A 15: 82,854,984 Q755H probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttll13 A T 7: 80,256,919 Y445F probably benign Het
Usp40 T C 1: 87,995,737 I271V possibly damaging Het
Vmn1r72 A G 7: 11,669,864 I219T probably damaging Het
Other mutations in Ptprr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Ptprr APN 10 116188317 missense probably benign 0.00
IGL01762:Ptprr APN 10 116236733 missense probably damaging 1.00
IGL02429:Ptprr APN 10 116273767 missense probably damaging 0.99
IGL03396:Ptprr APN 10 116188330 missense probably damaging 1.00
R0268:Ptprr UTSW 10 116252963 missense possibly damaging 0.83
R0584:Ptprr UTSW 10 116251158 missense probably damaging 0.96
R1388:Ptprr UTSW 10 116273752 missense probably benign 0.14
R1438:Ptprr UTSW 10 116256204 missense probably damaging 0.98
R1533:Ptprr UTSW 10 116188208 nonsense probably null
R1654:Ptprr UTSW 10 116188363 missense probably benign 0.43
R1793:Ptprr UTSW 10 116252922 missense probably damaging 1.00
R4081:Ptprr UTSW 10 116236710 missense probably benign 0.01
R4193:Ptprr UTSW 10 116252864 missense probably damaging 1.00
R4254:Ptprr UTSW 10 116162443 splice site probably null
R4799:Ptprr UTSW 10 116048218 missense probably benign 0.00
R5209:Ptprr UTSW 10 116162609 missense probably damaging 0.99
R5312:Ptprr UTSW 10 116188419 missense probably benign 0.28
R5410:Ptprr UTSW 10 116188330 missense possibly damaging 0.94
R5556:Ptprr UTSW 10 116251149 missense probably damaging 0.96
R5717:Ptprr UTSW 10 116048113 missense probably benign 0.11
R6039:Ptprr UTSW 10 116236763 splice site probably null
R6039:Ptprr UTSW 10 116236763 splice site probably null
R7013:Ptprr UTSW 10 116236754 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGGGCTGTTTCTTAGACATTAG -3'
(R):5'- GACGCCTAGTCTCGACATATATTTC -3'

Sequencing Primer
(F):5'- GCTGTTTCTTAGACATTAGCTTAACC -3'
(R):5'- CCTAGTCTCGACATATATTTCAACTC -3'
Posted On2015-07-21