Incidental Mutation 'R4496:Olfr787'
ID330985
Institutional Source Beutler Lab
Gene Symbol Olfr787
Ensembl Gene ENSMUSG00000096497
Gene Nameolfactory receptor 787
SynonymsMOR111-10, GA_x6K02T2PULF-11141498-11142436
MMRRC Submission 041749-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4496 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129461862-129467485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 129463561 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 295 (V295G)
Ref Sequence ENSEMBL: ENSMUSP00000149391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077836] [ENSMUST00000213329]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077836
AA Change: V295G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077005
Gene: ENSMUSG00000096497
AA Change: V295G

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 4e-49 PFAM
Pfam:7tm_1 39 288 2.1e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213329
AA Change: V295G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.0976 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,383,973 L514H possibly damaging Het
Abca7 T C 10: 80,002,934 F647S probably damaging Het
Ahi1 A G 10: 20,965,545 K244E probably benign Het
Ankhd1 G A 18: 36,560,786 D17N probably damaging Het
Arvcf G T 16: 18,405,182 K890N probably damaging Het
Atp11c T C X: 60,280,744 D478G probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Clca2 C T 3: 145,092,165 D180N possibly damaging Het
Comt T C 16: 18,411,687 probably null Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cyp2d11 C T 15: 82,391,948 probably benign Het
D10Jhu81e T C 10: 78,163,543 I145V probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fam169b G T 7: 68,358,206 C289F possibly damaging Het
Fam214a T A 9: 75,031,531 S1038T probably damaging Het
Fastkd5 T C 2: 130,616,581 T30A probably benign Het
Fchsd2 A C 7: 101,282,495 T753P probably benign Het
Glis3 G A 19: 28,666,127 S5L possibly damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Gpt A T 15: 76,698,463 Q276L probably damaging Het
Gtf3c3 G T 1: 54,424,132 S302R probably benign Het
Hnrnpc A G 14: 52,075,431 S229P probably benign Het
Ikzf5 T C 7: 131,396,664 probably null Het
Mal2 T C 15: 54,598,439 V110A probably damaging Het
Myo3b A G 2: 70,254,404 D702G probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nat10 T A 2: 103,757,739 I14F probably damaging Het
Nat14 C T 7: 4,923,919 T30M probably damaging Het
Ndst4 C A 3: 125,683,273 A49D probably damaging Het
Nnt A T 13: 119,381,765 M292K probably damaging Het
Obox7 C T 7: 14,665,374 T175I probably benign Het
Olfr1395 T A 11: 49,148,387 N43K possibly damaging Het
Plekhm3 T C 1: 64,861,236 E634G probably damaging Het
Plxdc2 T A 2: 16,512,229 I107K probably damaging Het
Psmb10 T A 8: 105,936,028 R226S probably damaging Het
Ptprr T A 10: 116,229,502 V160E possibly damaging Het
Sema5a T A 15: 32,640,987 L649H probably damaging Het
Sephs1 T A 2: 4,906,683 I356K probably benign Het
Serpinb3d C T 1: 107,079,292 V229M probably damaging Het
Slc7a4 T C 16: 17,575,812 D41G probably damaging Het
Sort1 T C 3: 108,310,145 V121A probably benign Het
Tcf20 C A 15: 82,854,984 Q755H probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttll13 A T 7: 80,256,919 Y445F probably benign Het
Usp40 T C 1: 87,995,737 I271V possibly damaging Het
Vmn1r72 A G 7: 11,669,864 I219T probably damaging Het
Other mutations in Olfr787
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0384:Olfr787 UTSW 10 129463040 nonsense probably null
R1851:Olfr787 UTSW 10 129463501 missense probably damaging 1.00
R2211:Olfr787 UTSW 10 129462940 missense probably damaging 1.00
R3613:Olfr787 UTSW 10 129463068 missense probably benign 0.29
R3701:Olfr787 UTSW 10 129462952 missense probably damaging 1.00
R3702:Olfr787 UTSW 10 129462952 missense probably damaging 1.00
R5745:Olfr787 UTSW 10 129463438 missense probably damaging 1.00
R6791:Olfr787 UTSW 10 129463154 missense probably benign 0.00
R7190:Olfr787 UTSW 10 129462757 missense probably benign 0.00
R7313:Olfr787 UTSW 10 129462987 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGCACCATTCTGAGGTTCC -3'
(R):5'- GCAACCATACTGTAGCATCTTTCAG -3'

Sequencing Primer
(F):5'- CAGAGGAAAAAGGCTTTCTCCACTTG -3'
(R):5'- CAGCATAGATGCCTGAGA -3'
Posted On2015-07-21