Incidental Mutation 'R4496:Nnt'
ID330988
Institutional Source Beutler Lab
Gene Symbol Nnt
Ensembl Gene ENSMUSG00000025453
Gene Namenicotinamide nucleotide transhydrogenase
Synonyms
MMRRC Submission 041749-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R4496 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location119335448-119408997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119381765 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 292 (M292K)
Ref Sequence ENSEMBL: ENSMUSP00000152868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069902] [ENSMUST00000099149] [ENSMUST00000109204] [ENSMUST00000223268]
Predicted Effect probably benign
Transcript: ENSMUST00000069902
AA Change: M292K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000070564
Gene: ENSMUSG00000025453
AA Change: M292K

DomainStartEndE-ValueType
AlaDh_PNT_N 60 199 3.35e-62 SMART
AlaDh_PNT_C 208 377 5.76e-43 SMART
transmembrane domain 409 431 N/A INTRINSIC
transmembrane domain 451 473 N/A INTRINSIC
transmembrane domain 486 508 N/A INTRINSIC
PDB:1U31|B 515 721 1e-145 PDB
SCOP:d1d4oa_ 542 718 1e-103 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099149
AA Change: M292K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096753
Gene: ENSMUSG00000025453
AA Change: M292K

DomainStartEndE-ValueType
AlaDh_PNT_N 60 199 3.35e-62 SMART
AlaDh_PNT_C 208 375 1.27e-39 SMART
transmembrane domain 395 412 N/A INTRINSIC
Blast:AlaDh_PNT_C 436 491 3e-28 BLAST
transmembrane domain 523 545 N/A INTRINSIC
transmembrane domain 565 587 N/A INTRINSIC
transmembrane domain 600 622 N/A INTRINSIC
PDB:1U31|B 629 835 1e-143 PDB
SCOP:d1d4oa_ 656 832 1e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109204
AA Change: M292K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000104827
Gene: ENSMUSG00000025453
AA Change: M292K

DomainStartEndE-ValueType
AlaDh_PNT_N 60 199 3.35e-62 SMART
AlaDh_PNT_C 208 375 1.27e-39 SMART
transmembrane domain 395 412 N/A INTRINSIC
Blast:AlaDh_PNT_C 436 491 2e-28 BLAST
transmembrane domain 523 545 N/A INTRINSIC
transmembrane domain 565 587 N/A INTRINSIC
transmembrane domain 600 622 N/A INTRINSIC
PDB:1U31|B 629 709 9e-46 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000223268
AA Change: M292K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mutations in this gene cause impaired glucose tolerance and loss of both glucose-dependent insulin secretion and ATP production in isolated pancreatic islets. Also, beta cells from ENU-induced mutants show enhanced glucose utilization and production of reactive oxygen species in response to glucose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,383,973 L514H possibly damaging Het
Abca7 T C 10: 80,002,934 F647S probably damaging Het
Ahi1 A G 10: 20,965,545 K244E probably benign Het
Ankhd1 G A 18: 36,560,786 D17N probably damaging Het
Arvcf G T 16: 18,405,182 K890N probably damaging Het
Atp11c T C X: 60,280,744 D478G probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Clca2 C T 3: 145,092,165 D180N possibly damaging Het
Comt T C 16: 18,411,687 probably null Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cyp2d11 C T 15: 82,391,948 probably benign Het
D10Jhu81e T C 10: 78,163,543 I145V probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fam169b G T 7: 68,358,206 C289F possibly damaging Het
Fam214a T A 9: 75,031,531 S1038T probably damaging Het
Fastkd5 T C 2: 130,616,581 T30A probably benign Het
Fchsd2 A C 7: 101,282,495 T753P probably benign Het
Glis3 G A 19: 28,666,127 S5L possibly damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Gpt A T 15: 76,698,463 Q276L probably damaging Het
Gtf3c3 G T 1: 54,424,132 S302R probably benign Het
Hnrnpc A G 14: 52,075,431 S229P probably benign Het
Ikzf5 T C 7: 131,396,664 probably null Het
Mal2 T C 15: 54,598,439 V110A probably damaging Het
Myo3b A G 2: 70,254,404 D702G probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nat10 T A 2: 103,757,739 I14F probably damaging Het
Nat14 C T 7: 4,923,919 T30M probably damaging Het
Ndst4 C A 3: 125,683,273 A49D probably damaging Het
Obox7 C T 7: 14,665,374 T175I probably benign Het
Olfr1395 T A 11: 49,148,387 N43K possibly damaging Het
Olfr787 T G 10: 129,463,561 V295G possibly damaging Het
Plekhm3 T C 1: 64,861,236 E634G probably damaging Het
Plxdc2 T A 2: 16,512,229 I107K probably damaging Het
Psmb10 T A 8: 105,936,028 R226S probably damaging Het
Ptprr T A 10: 116,229,502 V160E possibly damaging Het
Sema5a T A 15: 32,640,987 L649H probably damaging Het
Sephs1 T A 2: 4,906,683 I356K probably benign Het
Serpinb3d C T 1: 107,079,292 V229M probably damaging Het
Slc7a4 T C 16: 17,575,812 D41G probably damaging Het
Sort1 T C 3: 108,310,145 V121A probably benign Het
Tcf20 C A 15: 82,854,984 Q755H probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttll13 A T 7: 80,256,919 Y445F probably benign Het
Usp40 T C 1: 87,995,737 I271V possibly damaging Het
Vmn1r72 A G 7: 11,669,864 I219T probably damaging Het
Other mutations in Nnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nnt APN 13 119369997 missense probably damaging 1.00
IGL02021:Nnt APN 13 119336247 utr 3 prime probably benign
IGL02792:Nnt APN 13 119357646 missense probably damaging 1.00
IGL02804:Nnt APN 13 119381674 critical splice donor site probably null
IGL03082:Nnt APN 13 119396868 missense probably damaging 1.00
R0122:Nnt UTSW 13 119368597 missense probably damaging 1.00
R0294:Nnt UTSW 13 119336267 missense probably benign 0.08
R0294:Nnt UTSW 13 119338417 missense possibly damaging 0.79
R0530:Nnt UTSW 13 119394721 missense probably damaging 1.00
R0839:Nnt UTSW 13 119394656 missense possibly damaging 0.86
R1590:Nnt UTSW 13 119386661 missense possibly damaging 0.90
R1642:Nnt UTSW 13 119404550 critical splice donor site probably null
R3772:Nnt UTSW 13 119396952 missense probably damaging 0.99
R3835:Nnt UTSW 13 119372495 missense probably damaging 1.00
R3921:Nnt UTSW 13 119366494 missense probably damaging 1.00
R4106:Nnt UTSW 13 119396791 missense probably benign 0.15
R4609:Nnt UTSW 13 119357536 missense possibly damaging 0.80
R4897:Nnt UTSW 13 119404571 nonsense probably null
R5081:Nnt UTSW 13 119366400 missense probably damaging 0.98
R5461:Nnt UTSW 13 119368595 missense possibly damaging 0.96
R5842:Nnt UTSW 13 119394747 missense probably damaging 0.97
R6053:Nnt UTSW 13 119357509 missense possibly damaging 0.90
R6137:Nnt UTSW 13 119336328 missense possibly damaging 0.95
R7134:Nnt UTSW 13 119394662 missense probably damaging 0.98
Z1088:Nnt UTSW 13 119338446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTACTAAGTAGCATACCTGGAACCC -3'
(R):5'- ACTCTGTAGGGTTTATTTACAGCC -3'

Sequencing Primer
(F):5'- TGGAACCCTCCTGTAAATGTCAG -3'
(R):5'- GGGTTTATTTACAGCCACAGC -3'
Posted On2015-07-21