Incidental Mutation 'R4496:Slc7a4'
ID330995
Institutional Source Beutler Lab
Gene Symbol Slc7a4
Ensembl Gene ENSMUSG00000022756
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 4
Synonyms
MMRRC Submission 041749-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R4496 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17572018-17583214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17575812 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 41 (D41G)
Ref Sequence ENSEMBL: ENSMUSP00000156098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023441] [ENSMUST00000063544] [ENSMUST00000090165] [ENSMUST00000164490] [ENSMUST00000164545] [ENSMUST00000164623] [ENSMUST00000168383] [ENSMUST00000171002] [ENSMUST00000172164] [ENSMUST00000231283] [ENSMUST00000231552] [ENSMUST00000231615] [ENSMUST00000231645] [ENSMUST00000231806] [ENSMUST00000232186] [ENSMUST00000232226] [ENSMUST00000232336] [ENSMUST00000232385]
Predicted Effect probably benign
Transcript: ENSMUST00000023441
SMART Domains Protein: ENSMUSP00000023441
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 385 7.9e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063544
AA Change: D41G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067243
Gene: ENSMUSG00000022756
AA Change: D41G

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 436 1.4e-49 PFAM
Pfam:AA_permease 41 426 9.4e-38 PFAM
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 508 530 N/A INTRINSIC
Pfam:AA_permease_C 540 590 1.4e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090165
AA Change: D41G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087627
Gene: ENSMUSG00000022756
AA Change: D41G

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 368 1.2e-42 PFAM
Pfam:AA_permease 41 370 2.7e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116648
Predicted Effect probably damaging
Transcript: ENSMUST00000164490
AA Change: D41G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129223
Gene: ENSMUSG00000022756
AA Change: D41G

DomainStartEndE-ValueType
transmembrane domain 44 63 N/A INTRINSIC
low complexity region 70 82 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164545
AA Change: D106G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130375
Gene: ENSMUSG00000022756
AA Change: D106G

DomainStartEndE-ValueType
Pfam:AA_permease_2 102 231 9.8e-15 PFAM
Pfam:AA_permease 106 230 2.7e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164623
AA Change: D41G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133167
Gene: ENSMUSG00000022756
AA Change: D41G

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 140 1.5e-14 PFAM
Pfam:AA_permease 41 140 6.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168383
SMART Domains Protein: ENSMUSP00000130079
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 266 4.2e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171002
SMART Domains Protein: ENSMUSP00000132727
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 197 1e-65 PFAM
Pfam:P2X_receptor 185 362 7e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172164
AA Change: D41G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127280
Gene: ENSMUSG00000022756
AA Change: D41G

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 498 2.6e-46 PFAM
Pfam:AA_permease 41 423 4.5e-36 PFAM
transmembrane domain 508 530 N/A INTRINSIC
Pfam:AA_permease_C 540 590 1.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231283
AA Change: D41G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000231552
AA Change: D41G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000231615
AA Change: D41G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000231645
AA Change: D106G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000231806
Predicted Effect probably damaging
Transcript: ENSMUST00000232186
AA Change: D41G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232226
AA Change: D41G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000232336
AA Change: D41G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000232385
AA Change: D41G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232429
Meta Mutation Damage Score 0.438 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,383,973 L514H possibly damaging Het
Abca7 T C 10: 80,002,934 F647S probably damaging Het
Ahi1 A G 10: 20,965,545 K244E probably benign Het
Ankhd1 G A 18: 36,560,786 D17N probably damaging Het
Arvcf G T 16: 18,405,182 K890N probably damaging Het
Atp11c T C X: 60,280,744 D478G probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Clca2 C T 3: 145,092,165 D180N possibly damaging Het
Comt T C 16: 18,411,687 probably null Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cyp2d11 C T 15: 82,391,948 probably benign Het
D10Jhu81e T C 10: 78,163,543 I145V probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fam169b G T 7: 68,358,206 C289F possibly damaging Het
Fam214a T A 9: 75,031,531 S1038T probably damaging Het
Fastkd5 T C 2: 130,616,581 T30A probably benign Het
Fchsd2 A C 7: 101,282,495 T753P probably benign Het
Glis3 G A 19: 28,666,127 S5L possibly damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Gpt A T 15: 76,698,463 Q276L probably damaging Het
Gtf3c3 G T 1: 54,424,132 S302R probably benign Het
Hnrnpc A G 14: 52,075,431 S229P probably benign Het
Ikzf5 T C 7: 131,396,664 probably null Het
Mal2 T C 15: 54,598,439 V110A probably damaging Het
Myo3b A G 2: 70,254,404 D702G probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nat10 T A 2: 103,757,739 I14F probably damaging Het
Nat14 C T 7: 4,923,919 T30M probably damaging Het
Ndst4 C A 3: 125,683,273 A49D probably damaging Het
Nnt A T 13: 119,381,765 M292K probably damaging Het
Obox7 C T 7: 14,665,374 T175I probably benign Het
Olfr1395 T A 11: 49,148,387 N43K possibly damaging Het
Olfr787 T G 10: 129,463,561 V295G possibly damaging Het
Plekhm3 T C 1: 64,861,236 E634G probably damaging Het
Plxdc2 T A 2: 16,512,229 I107K probably damaging Het
Psmb10 T A 8: 105,936,028 R226S probably damaging Het
Ptprr T A 10: 116,229,502 V160E possibly damaging Het
Sema5a T A 15: 32,640,987 L649H probably damaging Het
Sephs1 T A 2: 4,906,683 I356K probably benign Het
Serpinb3d C T 1: 107,079,292 V229M probably damaging Het
Sort1 T C 3: 108,310,145 V121A probably benign Het
Tcf20 C A 15: 82,854,984 Q755H probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttll13 A T 7: 80,256,919 Y445F probably benign Het
Usp40 T C 1: 87,995,737 I271V possibly damaging Het
Vmn1r72 A G 7: 11,669,864 I219T probably damaging Het
Other mutations in Slc7a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02717:Slc7a4 APN 16 17574575 missense possibly damaging 0.90
R0066:Slc7a4 UTSW 16 17574011 missense probably benign 0.02
R0066:Slc7a4 UTSW 16 17574011 missense probably benign 0.02
R0402:Slc7a4 UTSW 16 17575633 missense probably damaging 1.00
R1426:Slc7a4 UTSW 16 17573944 critical splice donor site probably null
R1926:Slc7a4 UTSW 16 17575704 missense probably damaging 1.00
R2097:Slc7a4 UTSW 16 17573455 splice site probably null
R2140:Slc7a4 UTSW 16 17574544 missense possibly damaging 0.91
R4548:Slc7a4 UTSW 16 17575345 missense probably benign 0.01
R4570:Slc7a4 UTSW 16 17574277 missense probably benign 0.00
R4631:Slc7a4 UTSW 16 17574391 missense probably damaging 1.00
R4658:Slc7a4 UTSW 16 17575933 missense probably damaging 1.00
R4825:Slc7a4 UTSW 16 17574521 missense probably damaging 1.00
R5102:Slc7a4 UTSW 16 17575618 missense probably damaging 1.00
R5364:Slc7a4 UTSW 16 17573363 missense probably benign 0.33
R5650:Slc7a4 UTSW 16 17575684 missense possibly damaging 0.94
R5666:Slc7a4 UTSW 16 17575951 utr 5 prime probably benign
R5944:Slc7a4 UTSW 16 17574356 missense possibly damaging 0.95
R6769:Slc7a4 UTSW 16 17575320 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AGGTATGCTGAGCCAGTACG -3'
(R):5'- TGGGCTGTCTATGAAAGAATGG -3'

Sequencing Primer
(F):5'- CAGTACGGGGCACACGG -3'
(R):5'- AAAGAATGGAGGATGGTTGGTTATTC -3'
Posted On2015-07-21