Incidental Mutation 'R4496:Glis3'
ID331001
Institutional Source Beutler Lab
Gene Symbol Glis3
Ensembl Gene ENSMUSG00000052942
Gene NameGLIS family zinc finger 3
SynonymsE330013K21Rik, 4833409N03Rik
MMRRC Submission 041749-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R4496 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location28258851-28680077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28666127 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 5 (S5L)
Ref Sequence ENSEMBL: ENSMUSP00000124143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065113] [ENSMUST00000112612] [ENSMUST00000159178] [ENSMUST00000160376] [ENSMUST00000161328] [ENSMUST00000162022]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065113
AA Change: S5L

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066953
Gene: ENSMUSG00000052942
AA Change: S5L

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112612
AA Change: S5L

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108231
Gene: ENSMUSG00000052942
AA Change: S5L

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
low complexity region 203 222 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
ZnF_C2H2 500 525 1.07e0 SMART
ZnF_C2H2 534 561 6.13e-1 SMART
ZnF_C2H2 567 591 3.89e-3 SMART
ZnF_C2H2 597 621 1.45e-2 SMART
ZnF_C2H2 627 651 9.08e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159178
AA Change: S5L

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124823
Gene: ENSMUSG00000052942
AA Change: S5L

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
low complexity region 203 222 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160376
AA Change: S5L

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124143
Gene: ENSMUSG00000052942
AA Change: S5L

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161328
AA Change: S5L

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125721
Gene: ENSMUSG00000052942
AA Change: S5L

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
low complexity region 203 222 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162022
AA Change: S5L

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124635
Gene: ENSMUSG00000052942
AA Change: S5L

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
low complexity region 203 222 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
ZnF_C2H2 500 525 1.07e0 SMART
ZnF_C2H2 534 561 6.13e-1 SMART
ZnF_C2H2 567 591 3.89e-3 SMART
ZnF_C2H2 597 621 1.45e-2 SMART
ZnF_C2H2 627 651 9.08e-4 SMART
low complexity region 700 709 N/A INTRINSIC
low complexity region 722 746 N/A INTRINSIC
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene is a member of the GLI-similar zinc finger protein family and encodes a nuclear protein which contains multiple C2H2-type zinc finger domains. This protein functions as both a repressor and activator of transcription and is specifically involved in the transcriptional regulation of insulin. It is thought to enhance GLI-RE-dependent transcription by binding to the GLI-RE consensus sequence (GACCACCCAC). Mutations in a similar gene in human have been associated with neonatal diabetes and congenital hypothyroidism (NDH). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit postnatal lethality associated with neonatal diabetes and polycystic kidney disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,383,973 L514H possibly damaging Het
Abca7 T C 10: 80,002,934 F647S probably damaging Het
Ahi1 A G 10: 20,965,545 K244E probably benign Het
Ankhd1 G A 18: 36,560,786 D17N probably damaging Het
Arvcf G T 16: 18,405,182 K890N probably damaging Het
Atp11c T C X: 60,280,744 D478G probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Clca2 C T 3: 145,092,165 D180N possibly damaging Het
Comt T C 16: 18,411,687 probably null Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cyp2d11 C T 15: 82,391,948 probably benign Het
D10Jhu81e T C 10: 78,163,543 I145V probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fam169b G T 7: 68,358,206 C289F possibly damaging Het
Fam214a T A 9: 75,031,531 S1038T probably damaging Het
Fastkd5 T C 2: 130,616,581 T30A probably benign Het
Fchsd2 A C 7: 101,282,495 T753P probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Gpt A T 15: 76,698,463 Q276L probably damaging Het
Gtf3c3 G T 1: 54,424,132 S302R probably benign Het
Hnrnpc A G 14: 52,075,431 S229P probably benign Het
Ikzf5 T C 7: 131,396,664 probably null Het
Mal2 T C 15: 54,598,439 V110A probably damaging Het
Myo3b A G 2: 70,254,404 D702G probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nat10 T A 2: 103,757,739 I14F probably damaging Het
Nat14 C T 7: 4,923,919 T30M probably damaging Het
Ndst4 C A 3: 125,683,273 A49D probably damaging Het
Nnt A T 13: 119,381,765 M292K probably damaging Het
Obox7 C T 7: 14,665,374 T175I probably benign Het
Olfr1395 T A 11: 49,148,387 N43K possibly damaging Het
Olfr787 T G 10: 129,463,561 V295G possibly damaging Het
Plekhm3 T C 1: 64,861,236 E634G probably damaging Het
Plxdc2 T A 2: 16,512,229 I107K probably damaging Het
Psmb10 T A 8: 105,936,028 R226S probably damaging Het
Ptprr T A 10: 116,229,502 V160E possibly damaging Het
Sema5a T A 15: 32,640,987 L649H probably damaging Het
Sephs1 T A 2: 4,906,683 I356K probably benign Het
Serpinb3d C T 1: 107,079,292 V229M probably damaging Het
Slc7a4 T C 16: 17,575,812 D41G probably damaging Het
Sort1 T C 3: 108,310,145 V121A probably benign Het
Tcf20 C A 15: 82,854,984 Q755H probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttll13 A T 7: 80,256,919 Y445F probably benign Het
Usp40 T C 1: 87,995,737 I271V possibly damaging Het
Vmn1r72 A G 7: 11,669,864 I219T probably damaging Het
Other mutations in Glis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Glis3 APN 19 28540264 missense probably damaging 1.00
IGL02240:Glis3 APN 19 28531525 missense probably damaging 1.00
IGL02347:Glis3 APN 19 28531883 missense probably benign
IGL02904:Glis3 APN 19 28357952 missense possibly damaging 0.58
glee UTSW 19 28262677 utr 3 prime probably benign
R0071:Glis3 UTSW 19 28263855 splice site probably benign
R0071:Glis3 UTSW 19 28263855 splice site probably benign
R0106:Glis3 UTSW 19 28531868 missense possibly damaging 0.67
R0106:Glis3 UTSW 19 28531868 missense possibly damaging 0.67
R0399:Glis3 UTSW 19 28298768 splice site probably benign
R1462:Glis3 UTSW 19 28262518 utr 3 prime probably benign
R1901:Glis3 UTSW 19 28531585 missense probably damaging 1.00
R1976:Glis3 UTSW 19 28262677 utr 3 prime probably benign
R1982:Glis3 UTSW 19 28531274 missense probably damaging 1.00
R2155:Glis3 UTSW 19 28531302 missense probably benign 0.16
R3723:Glis3 UTSW 19 28262591 nonsense probably null
R4921:Glis3 UTSW 19 28666104 missense probably damaging 1.00
R5088:Glis3 UTSW 19 28531579 missense probably benign 0.00
R5241:Glis3 UTSW 19 28350023 missense probably benign 0.02
R5557:Glis3 UTSW 19 28264009 missense probably benign 0.00
R6226:Glis3 UTSW 19 28317302 missense probably damaging 1.00
R6309:Glis3 UTSW 19 28317361 missense probably benign 0.24
R6488:Glis3 UTSW 19 28298853 missense probably benign 0.13
R7069:Glis3 UTSW 19 28531519 missense probably damaging 1.00
R7260:Glis3 UTSW 19 28531402 missense probably benign
R7313:Glis3 UTSW 19 28531019 missense probably damaging 1.00
R7320:Glis3 UTSW 19 28531598 missense probably damaging 1.00
T0970:Glis3 UTSW 19 28530932 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGAGGTGAAGACTGTTAGC -3'
(R):5'- GTTCTATAACAGAGGCCAGTTTG -3'

Sequencing Primer
(F):5'- TTAGCAAGACTTCCAATACTGGGGC -3'
(R):5'- CGAGTTGAAAACTTTCTGGATCTC -3'
Posted On2015-07-21