Incidental Mutation 'R4496:Atp11c'
ID331002
Institutional Source Beutler Lab
Gene Symbol Atp11c
Ensembl Gene ENSMUSG00000062949
Gene NameATPase, class VI, type 11C
SynonymsIg, A330005H02Rik
MMRRC Submission 041749-MU
Accession Numbers

Genbank: NM_001001798; MGI: 1859661

Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R4496 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location60223290-60592698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60280744 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 478 (D478G)
Ref Sequence ENSEMBL: ENSMUSP00000033480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033480] [ENSMUST00000101527] [ENSMUST00000154051]
Predicted Effect probably damaging
Transcript: ENSMUST00000033480
AA Change: D478G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033480
Gene: ENSMUSG00000062949
AA Change: D478G

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Pfam:E1-E2_ATPase 94 379 5.2e-18 PFAM
Pfam:Hydrolase 403 827 1.6e-12 PFAM
Pfam:HAD 406 825 9.2e-21 PFAM
Pfam:Hydrolase_like2 467 576 1.3e-14 PFAM
low complexity region 853 865 N/A INTRINSIC
low complexity region 994 1013 N/A INTRINSIC
low complexity region 1068 1085 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101527
AA Change: D478G

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099066
Gene: ENSMUSG00000062949
AA Change: D478G

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Pfam:E1-E2_ATPase 94 379 1.2e-17 PFAM
Pfam:Hydrolase 403 827 1.8e-12 PFAM
Pfam:HAD 406 825 1.4e-20 PFAM
Pfam:Hydrolase_like2 467 576 3.7e-14 PFAM
low complexity region 853 865 N/A INTRINSIC
low complexity region 994 1013 N/A INTRINSIC
low complexity region 1068 1085 N/A INTRINSIC
low complexity region 1091 1105 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138569
Predicted Effect possibly damaging
Transcript: ENSMUST00000154051
AA Change: D478G

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119320
Gene: ENSMUSG00000062949
AA Change: D478G

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 22 91 2.6e-25 PFAM
Pfam:E1-E2_ATPase 96 371 2.7e-13 PFAM
Pfam:Hydrolase 403 725 2.4e-7 PFAM
Pfam:HAD 406 825 3.4e-19 PFAM
Pfam:Cation_ATPase 467 576 8.6e-14 PFAM
Pfam:PhoLip_ATPase_C 842 1094 3.4e-71 PFAM
Meta Mutation Damage Score 0.1868 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous or hemizygous for an ENU mutation exhibit decreased B cells associated with arrested adult B cell lymphopoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,383,973 L514H possibly damaging Het
Abca7 T C 10: 80,002,934 F647S probably damaging Het
Ahi1 A G 10: 20,965,545 K244E probably benign Het
Ankhd1 G A 18: 36,560,786 D17N probably damaging Het
Arvcf G T 16: 18,405,182 K890N probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Clca2 C T 3: 145,092,165 D180N possibly damaging Het
Comt T C 16: 18,411,687 probably null Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cyp2d11 C T 15: 82,391,948 probably benign Het
D10Jhu81e T C 10: 78,163,543 I145V probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fam169b G T 7: 68,358,206 C289F possibly damaging Het
Fam214a T A 9: 75,031,531 S1038T probably damaging Het
Fastkd5 T C 2: 130,616,581 T30A probably benign Het
Fchsd2 A C 7: 101,282,495 T753P probably benign Het
Glis3 G A 19: 28,666,127 S5L possibly damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Gpt A T 15: 76,698,463 Q276L probably damaging Het
Gtf3c3 G T 1: 54,424,132 S302R probably benign Het
Hnrnpc A G 14: 52,075,431 S229P probably benign Het
Ikzf5 T C 7: 131,396,664 probably null Het
Mal2 T C 15: 54,598,439 V110A probably damaging Het
Myo3b A G 2: 70,254,404 D702G probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nat10 T A 2: 103,757,739 I14F probably damaging Het
Nat14 C T 7: 4,923,919 T30M probably damaging Het
Ndst4 C A 3: 125,683,273 A49D probably damaging Het
Nnt A T 13: 119,381,765 M292K probably damaging Het
Obox7 C T 7: 14,665,374 T175I probably benign Het
Olfr1395 T A 11: 49,148,387 N43K possibly damaging Het
Olfr787 T G 10: 129,463,561 V295G possibly damaging Het
Plekhm3 T C 1: 64,861,236 E634G probably damaging Het
Plxdc2 T A 2: 16,512,229 I107K probably damaging Het
Psmb10 T A 8: 105,936,028 R226S probably damaging Het
Ptprr T A 10: 116,229,502 V160E possibly damaging Het
Sema5a T A 15: 32,640,987 L649H probably damaging Het
Sephs1 T A 2: 4,906,683 I356K probably benign Het
Serpinb3d C T 1: 107,079,292 V229M probably damaging Het
Slc7a4 T C 16: 17,575,812 D41G probably damaging Het
Sort1 T C 3: 108,310,145 V121A probably benign Het
Tcf20 C A 15: 82,854,984 Q755H probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttll13 A T 7: 80,256,919 Y445F probably benign Het
Usp40 T C 1: 87,995,737 I271V possibly damaging Het
Vmn1r72 A G 7: 11,669,864 I219T probably damaging Het
Other mutations in Atp11c
AlleleSourceChrCoordTypePredicted EffectPPH Score
18nih30a APN X 36608577 unclassified probably benign
ambrosius APN X 36608577 unclassified probably benign
IGL00578:Atp11c APN X 60240817 missense probably damaging 1.00
IGL01702:Atp11c APN X 60269903 missense probably damaging 0.96
emptyhive UTSW X 60269987 nonsense probably null
hit UTSW X nonsense
spelling UTSW X 60290036 missense probably damaging 1.00
R1551:Atp11c UTSW X 60236712 critical splice acceptor site probably null
R2134:Atp11c UTSW X 60276783 missense probably damaging 1.00
R3687:Atp11c UTSW X 60281644 missense probably benign 0.07
R3688:Atp11c UTSW X 60281644 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGCACATGACTGAGTTACTGAAG -3'
(R):5'- GGAACCAGTAATTGTATTCGTTGC -3'

Sequencing Primer
(F):5'- CATGACTGAGTTACTGAAGCAAATG -3'
(R):5'- AATTGTATTCGTTGCTATGTAGTCG -3'
Posted On2015-07-21