Incidental Mutation 'R0069:Nacc1'
ID33106
Institutional Source Beutler Lab
Gene Symbol Nacc1
Ensembl Gene ENSMUSG00000001910
Gene Namenucleus accumbens associated 1, BEN and BTB (POZ) domain containing
SynonymsBtbd14b, 2010001H03Rik, 4930511N13Rik, Nac1
MMRRC Submission 038360-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0069 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location84670483-84687862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84677199 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 16 (I16F)
Ref Sequence ENSEMBL: ENSMUSP00000001975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001975]
Predicted Effect probably damaging
Transcript: ENSMUST00000001975
AA Change: I16F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001975
Gene: ENSMUSG00000001910
AA Change: I16F

DomainStartEndE-ValueType
BTB 30 124 4.05e-25 SMART
low complexity region 135 146 N/A INTRINSIC
low complexity region 224 235 N/A INTRINSIC
low complexity region 252 264 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
BEN 382 457 6.4e-18 SMART
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BTB/POZ protein family. BTB/POZ proteins are involved in several cellular processes including proliferation, apoptosis and transcription regulation. The encoded protein is a transcriptional repressor that plays a role in stem cell self-renewal and pluripotency maintenance. The encoded protein also suppresses transcription of the candidate tumor suppressor Gadd45GIP1, and expression of this gene may play a role in the progression of multiple types of cancer. A pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to cocaine and amphetamine. Mice homozygous for a different knock-out allele exhibit thoracic vertebral transformation and loss of the sixth lumbar vertebrae with decreaed rib number and reduced chondrocyte migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,561,562 C632S probably damaging Het
Antxr2 T A 5: 97,948,250 M392L possibly damaging Het
Cd101 A G 3: 101,008,217 V678A probably benign Het
Clec2g T A 6: 128,948,753 S42T probably benign Het
Clec2g T C 6: 128,980,311 probably null Het
Creb1 A G 1: 64,576,208 I240V possibly damaging Het
D2hgdh G T 1: 93,835,287 V265L possibly damaging Het
Dctn2 A T 10: 127,277,485 probably null Het
Diablo A T 5: 123,518,024 S117R probably damaging Het
Ebf2 A T 14: 67,410,050 R349S probably damaging Het
Fam168a C T 7: 100,835,411 A252V probably benign Het
Fbn2 T C 18: 58,069,184 Y1299C probably damaging Het
Gne A C 4: 44,060,099 V98G probably damaging Het
Hk2 A G 6: 82,736,528 probably null Het
Ifi206 A T 1: 173,486,847 V9D probably damaging Het
Ints3 A G 3: 90,400,647 probably benign Het
Itgal A G 7: 127,310,331 T56A probably benign Het
Lzts3 T A 2: 130,636,540 T213S probably benign Het
Map1b A G 13: 99,429,848 S2122P unknown Het
Mei4 C T 9: 82,025,582 Q223* probably null Het
Mpzl3 T C 9: 45,068,252 V167A probably damaging Het
Myo1d A G 11: 80,637,953 I681T probably damaging Het
Myom2 A G 8: 15,117,624 T1070A probably benign Het
Nfx1 T C 4: 40,986,688 probably benign Het
Olfr1335 A T 4: 118,809,690 V58D probably damaging Het
Olfr952 A G 9: 39,426,892 Y60H probably damaging Het
Ostm1 A C 10: 42,692,956 D37A probably benign Het
Pde8a T C 7: 81,319,123 probably benign Het
Pole2 A T 12: 69,209,887 V288E probably damaging Het
Poteg T C 8: 27,447,821 S2P probably benign Het
Ppp2r5c A T 12: 110,567,770 M356L probably benign Het
Prkdc G A 16: 15,726,504 S1786N probably benign Het
Prox1 A G 1: 190,160,919 V443A possibly damaging Het
Prpf6 T A 2: 181,615,963 probably null Het
Ptger1 A T 8: 83,668,319 T142S possibly damaging Het
Rad54l2 C A 9: 106,710,365 V734L possibly damaging Het
Rnpepl1 T A 1: 92,918,898 N507K possibly damaging Het
Slc38a10 A T 11: 120,106,502 V722E probably damaging Het
Slfn10-ps A G 11: 83,035,542 noncoding transcript Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sult1e1 A T 5: 87,579,897 H175Q probably damaging Het
Ube2e3 C A 2: 78,919,949 probably benign Het
Vmn1r208 A T 13: 22,772,425 W301R probably benign Het
Vps13d A G 4: 145,062,563 I746T probably benign Het
Xpnpep3 T C 15: 81,430,798 V233A probably benign Het
Zfp329 A T 7: 12,810,932 S222T probably damaging Het
Zswim6 T C 13: 107,738,563 noncoding transcript Het
Other mutations in Nacc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0052:Nacc1 UTSW 8 84676225 missense probably benign 0.00
R0145:Nacc1 UTSW 8 84674875 splice site probably benign
R0732:Nacc1 UTSW 8 84676201 missense probably damaging 0.96
R1966:Nacc1 UTSW 8 84676381 missense probably damaging 1.00
R2064:Nacc1 UTSW 8 84673118 missense probably benign 0.18
R3709:Nacc1 UTSW 8 84677199 missense probably damaging 1.00
R4409:Nacc1 UTSW 8 84673044 makesense probably null
R5428:Nacc1 UTSW 8 84676154 missense probably damaging 1.00
R6014:Nacc1 UTSW 8 84675071 missense possibly damaging 0.93
R6341:Nacc1 UTSW 8 84674791 missense probably benign 0.09
R6862:Nacc1 UTSW 8 84673215 missense probably damaging 1.00
R7288:Nacc1 UTSW 8 84676545 missense probably benign
Z1088:Nacc1 UTSW 8 84673286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTGGTCTCCCATGTTCATGCTC -3'
(R):5'- GCTGTTGTTTGTGACTCCCACATGC -3'

Sequencing Primer
(F):5'- CCGGCCTGTGTAACAAAATGTG -3'
(R):5'- GTGACTCCCACATGCTCTCC -3'
Posted On2013-05-09