Incidental Mutation 'R0069:Olfr952'
ID33107
Institutional Source Beutler Lab
Gene Symbol Olfr952
Ensembl Gene ENSMUSG00000058856
Gene Nameolfactory receptor 952
SynonymsMOR171-21, GA_x6K02T2PVTD-33124064-33123120
MMRRC Submission 038360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R0069 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location39426093-39427148 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39426892 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 60 (Y60H)
Ref Sequence ENSEMBL: ENSMUSP00000073558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073895]
Predicted Effect probably damaging
Transcript: ENSMUST00000073895
AA Change: Y60H

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073558
Gene: ENSMUSG00000058856
AA Change: Y60H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.5e-42 PFAM
Pfam:7tm_1 41 294 3.2e-18 PFAM
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,561,562 C632S probably damaging Het
Antxr2 T A 5: 97,948,250 M392L possibly damaging Het
Cd101 A G 3: 101,008,217 V678A probably benign Het
Clec2g T A 6: 128,948,753 S42T probably benign Het
Clec2g T C 6: 128,980,311 probably null Het
Creb1 A G 1: 64,576,208 I240V possibly damaging Het
D2hgdh G T 1: 93,835,287 V265L possibly damaging Het
Dctn2 A T 10: 127,277,485 probably null Het
Diablo A T 5: 123,518,024 S117R probably damaging Het
Ebf2 A T 14: 67,410,050 R349S probably damaging Het
Fam168a C T 7: 100,835,411 A252V probably benign Het
Fbn2 T C 18: 58,069,184 Y1299C probably damaging Het
Gne A C 4: 44,060,099 V98G probably damaging Het
Hk2 A G 6: 82,736,528 probably null Het
Ifi206 A T 1: 173,486,847 V9D probably damaging Het
Ints3 A G 3: 90,400,647 probably benign Het
Itgal A G 7: 127,310,331 T56A probably benign Het
Lzts3 T A 2: 130,636,540 T213S probably benign Het
Map1b A G 13: 99,429,848 S2122P unknown Het
Mei4 C T 9: 82,025,582 Q223* probably null Het
Mpzl3 T C 9: 45,068,252 V167A probably damaging Het
Myo1d A G 11: 80,637,953 I681T probably damaging Het
Myom2 A G 8: 15,117,624 T1070A probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Nfx1 T C 4: 40,986,688 probably benign Het
Olfr1335 A T 4: 118,809,690 V58D probably damaging Het
Ostm1 A C 10: 42,692,956 D37A probably benign Het
Pde8a T C 7: 81,319,123 probably benign Het
Pole2 A T 12: 69,209,887 V288E probably damaging Het
Poteg T C 8: 27,447,821 S2P probably benign Het
Ppp2r5c A T 12: 110,567,770 M356L probably benign Het
Prkdc G A 16: 15,726,504 S1786N probably benign Het
Prox1 A G 1: 190,160,919 V443A possibly damaging Het
Prpf6 T A 2: 181,615,963 probably null Het
Ptger1 A T 8: 83,668,319 T142S possibly damaging Het
Rad54l2 C A 9: 106,710,365 V734L possibly damaging Het
Rnpepl1 T A 1: 92,918,898 N507K possibly damaging Het
Slc38a10 A T 11: 120,106,502 V722E probably damaging Het
Slfn10-ps A G 11: 83,035,542 noncoding transcript Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sult1e1 A T 5: 87,579,897 H175Q probably damaging Het
Ube2e3 C A 2: 78,919,949 probably benign Het
Vmn1r208 A T 13: 22,772,425 W301R probably benign Het
Vps13d A G 4: 145,062,563 I746T probably benign Het
Xpnpep3 T C 15: 81,430,798 V233A probably benign Het
Zfp329 A T 7: 12,810,932 S222T probably damaging Het
Zswim6 T C 13: 107,738,563 noncoding transcript Het
Other mutations in Olfr952
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Olfr952 APN 9 39426657 missense probably benign 0.02
IGL01368:Olfr952 APN 9 39426180 missense probably damaging 1.00
IGL01866:Olfr952 APN 9 39426729 missense probably damaging 0.99
IGL01939:Olfr952 APN 9 39426338 missense probably damaging 1.00
IGL03048:Olfr952 UTSW 9 39426769 missense probably benign 0.00
R1460:Olfr952 UTSW 9 39426207 missense probably benign 0.43
R1478:Olfr952 UTSW 9 39426592 missense possibly damaging 0.91
R1737:Olfr952 UTSW 9 39426958 missense probably damaging 0.99
R2112:Olfr952 UTSW 9 39426670 missense probably benign 0.26
R2169:Olfr952 UTSW 9 39426358 missense possibly damaging 0.95
R2225:Olfr952 UTSW 9 39426619 missense probably benign 0.00
R3731:Olfr952 UTSW 9 39427069 start codon destroyed probably benign 0.23
R3777:Olfr952 UTSW 9 39426605 missense possibly damaging 0.75
R3802:Olfr952 UTSW 9 39426286 missense probably damaging 1.00
R4600:Olfr952 UTSW 9 39426435 missense probably benign 0.27
R4887:Olfr952 UTSW 9 39426235 missense possibly damaging 0.80
R5215:Olfr952 UTSW 9 39426623 nonsense probably null
R5813:Olfr952 UTSW 9 39426736 missense probably damaging 1.00
R6140:Olfr952 UTSW 9 39426247 missense possibly damaging 0.91
R6180:Olfr952 UTSW 9 39426712 missense probably damaging 1.00
R6383:Olfr952 UTSW 9 39426234 missense probably damaging 1.00
R6416:Olfr952 UTSW 9 39426891 missense probably damaging 0.98
R6808:Olfr952 UTSW 9 39426540 missense probably damaging 0.99
R7099:Olfr952 UTSW 9 39426303 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCCAGAGGATTTAATGTGCAAAATGC -3'
(R):5'- CCCCAGTGGCAGAGTTCATTCTTG -3'

Sequencing Primer
(F):5'- CACATAGCGGTCATATGCCATTG -3'
(R):5'- CTTGCTGGTTTAACAGAGAATCC -3'
Posted On2013-05-09