Incidental Mutation 'R4508:Fbp2'
ID331087
Institutional Source Beutler Lab
Gene Symbol Fbp2
Ensembl Gene ENSMUSG00000021456
Gene Namefructose bisphosphatase 2
SynonymsFbp-1, FBPase muscle
MMRRC Submission 041757-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R4508 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location62836877-62858422 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62841865 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 209 (I209N)
Ref Sequence ENSEMBL: ENSMUSP00000021907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021907]
Predicted Effect probably damaging
Transcript: ENSMUST00000021907
AA Change: I209N

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021907
Gene: ENSMUSG00000021456
AA Change: I209N

DomainStartEndE-ValueType
Pfam:FBPase 12 334 1.1e-138 PFAM
Pfam:Inositol_P 31 127 5.2e-7 PFAM
Meta Mutation Damage Score 0.308 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gluconeogenesis regulatory enzyme which catalyzes the hydrolysis of fructose 1,6-bisphosphate to fructose 6-phosphate and inorganic phosphate. [provided by RefSeq, Jul 2008]
PHENOTYPE: This locus controls electrophoretic variation of fructose bisphosphatase isozymes in muscle. Isozymes of kidney, liver and testis are not affected. P, SEA, SWR and Peru-Coppock have a slow migrating band; SM, C3H/He, C57BL/Go, CE and DBA/2 have a fast migrating band. Heterozygotes are intermediate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A G 2: 150,904,355 probably benign Het
Amer3 A G 1: 34,588,299 R540G probably benign Het
Ank C T 15: 27,564,977 R255W probably damaging Het
Ank3 A C 10: 69,892,370 I629L probably damaging Het
Arhgap11a T A 2: 113,842,042 N194Y probably damaging Het
BB014433 T C 8: 15,042,095 T253A possibly damaging Het
Ccdc40 C A 11: 119,242,509 D534E probably damaging Het
Chrna2 C A 14: 66,146,453 N106K probably damaging Het
Clec2f C A 6: 129,020,511 noncoding transcript Het
Cnnm2 G A 19: 46,877,270 D766N probably benign Het
Ctc1 A G 11: 69,016,117 probably null Het
Ddc C T 11: 11,819,393 probably null Het
Doc2g G A 19: 4,004,036 probably benign Het
Ep400 T C 5: 110,703,615 T1334A unknown Het
Epdr1 T C 13: 19,594,489 I44V probably benign Het
Fam71f1 T C 6: 29,323,765 V163A probably benign Het
Gldc G T 19: 30,143,407 Q375K probably damaging Het
Hc A C 2: 35,013,065 V1058G possibly damaging Het
Hydin T A 8: 110,519,254 S2200T possibly damaging Het
Kcnc1 C T 7: 46,428,288 P505S probably benign Het
Kifc3 T C 8: 95,107,420 probably null Het
Klhl10 A G 11: 100,442,176 E49G possibly damaging Het
Lhx5 T C 5: 120,435,434 S161P probably damaging Het
Lilra6 G T 7: 3,912,029 Y455* probably null Het
Lzts1 C T 8: 69,135,618 R562H probably benign Het
Muc6 G A 7: 141,640,089 probably benign Het
Ogfod2 C T 5: 124,113,254 Q74* probably null Het
Olfr1305 A C 2: 111,873,602 D84E probably damaging Het
Olfr183 T A 16: 58,999,775 V30E probably benign Het
Polr2a T C 11: 69,742,559 probably null Het
Ptpre T C 7: 135,669,103 L329P probably damaging Het
Rnh1 T C 7: 141,164,543 Q73R possibly damaging Het
Scly G A 1: 91,308,325 V100I possibly damaging Het
Sos2 A T 12: 69,635,661 L261* probably null Het
Sp1 A C 15: 102,409,312 Q422P possibly damaging Het
Sp3 A T 2: 72,970,397 F468Y probably damaging Het
Tenm2 T C 11: 36,008,345 Y2662C possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss2 C A 16: 97,570,427 G281C probably damaging Het
Tmprss6 A T 15: 78,459,778 Y183N probably damaging Het
Ttn A T 2: 76,750,340 L23403Q probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r90 T C 7: 14,562,159 N5D probably benign Het
Vps13b A G 15: 35,709,673 D1922G possibly damaging Het
Wrb T A 16: 96,145,699 probably benign Het
Other mutations in Fbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Fbp2 APN 13 62841884 missense possibly damaging 0.90
IGL01284:Fbp2 APN 13 62840285 missense probably benign 0.32
R0020:Fbp2 UTSW 13 62854048 missense probably damaging 1.00
R0062:Fbp2 UTSW 13 62854048 missense probably damaging 1.00
R0063:Fbp2 UTSW 13 62854048 missense probably damaging 1.00
R0064:Fbp2 UTSW 13 62854048 missense probably damaging 1.00
R0064:Fbp2 UTSW 13 62854048 missense probably damaging 1.00
R0218:Fbp2 UTSW 13 62854048 missense probably damaging 1.00
R0219:Fbp2 UTSW 13 62854048 missense probably damaging 1.00
R0241:Fbp2 UTSW 13 62854048 missense probably damaging 1.00
R1530:Fbp2 UTSW 13 62837159 missense probably damaging 1.00
R2069:Fbp2 UTSW 13 62854061 missense possibly damaging 0.68
R2091:Fbp2 UTSW 13 62858207 missense probably damaging 0.99
R2192:Fbp2 UTSW 13 62858242 missense possibly damaging 0.88
R3943:Fbp2 UTSW 13 62841793 missense possibly damaging 0.66
R4092:Fbp2 UTSW 13 62840360 missense possibly damaging 0.94
R4124:Fbp2 UTSW 13 62854941 missense probably damaging 1.00
R4841:Fbp2 UTSW 13 62854913 missense probably benign 0.29
R5576:Fbp2 UTSW 13 62837191 missense probably benign 0.00
R5893:Fbp2 UTSW 13 62837102 missense probably benign 0.03
R6989:Fbp2 UTSW 13 62858177 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCAGATGAGAGTTGTAAACACTG -3'
(R):5'- AGACACCACATGGCAGGTTC -3'

Sequencing Primer
(F):5'- GAGTTGTAAACACTGGTATCAACCC -3'
(R):5'- CATGGCAGGTTCCAGATGACTG -3'
Posted On2015-07-21