Incidental Mutation 'R4509:Pah'
ID331127
Institutional Source Beutler Lab
Gene Symbol Pah
Ensembl Gene ENSMUSG00000020051
Gene Namephenylalanine hydroxylase
SynonymsAW106920, OTTMUSP00000027786, PH, PKU, PKU1
MMRRC Submission 041758-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4509 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location87521795-87584136 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 87576215 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020241] [ENSMUST00000219813]
Predicted Effect probably null
Transcript: ENSMUST00000020241
SMART Domains Protein: ENSMUSP00000020241
Gene: ENSMUSG00000020051

DomainStartEndE-ValueType
Pfam:ACT 35 100 1.8e-10 PFAM
Pfam:Biopterin_H 119 449 1.3e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218573
Predicted Effect probably benign
Transcript: ENSMUST00000219813
Meta Mutation Damage Score 0.47 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAH encodes the enzyme phenylalanine hydroxylase that is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for ENU-induced mutations of this gene have altered serum and urine phenylalanine levels and may display reduced body size, microcephaly, microphthalmia, decreased litter size, hypopigmentation, impaired balance/swimming, cognitive deficits, and environmentally-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,966,755 L657P probably damaging Het
Adam4 A T 12: 81,421,747 C33* probably null Het
Adam6b T C 12: 113,490,352 V263A probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
Ascc3 T C 10: 50,842,243 F2011L probably benign Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Cacna1d T C 14: 30,096,971 Y1209C probably damaging Het
Camta2 G A 11: 70,681,018 T484M probably benign Het
Ccdc178 T C 18: 22,067,392 N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cttnbp2nl T C 3: 105,032,747 N2S probably damaging Het
Gm15032 A T X: 142,622,626 noncoding transcript Het
Gzmg G A 14: 56,156,753 P228L probably damaging Het
Hao1 T A 2: 134,523,044 D221V probably damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Mdn1 C T 4: 32,715,883 R2022C probably damaging Het
Mipep T C 14: 60,827,321 Y375H probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Perm1 T C 4: 156,217,586 S196P probably benign Het
Pik3c2g A T 6: 139,720,006 T18S probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Ppp3cb A T 14: 20,515,501 probably benign Het
Psd4 T C 2: 24,396,335 S316P probably benign Het
Ptpn18 T C 1: 34,462,742 V45A possibly damaging Het
Rasgrp3 A G 17: 75,500,673 M242V probably damaging Het
Repin1 T C 6: 48,596,526 C130R possibly damaging Het
Rrp1 G T 10: 78,412,822 T44K possibly damaging Het
Slc44a5 A G 3: 154,234,073 Y88C probably damaging Het
Socs1 C T 16: 10,784,354 R173Q probably benign Het
Speer3 T G 5: 13,796,354 N229K possibly damaging Het
Sult2a7 T A 7: 14,470,161 I226F probably damaging Het
Tdp1 G A 12: 99,955,065 probably benign Het
Tnfrsf21 G A 17: 43,085,388 S521N probably benign Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Ubqln3 G A 7: 104,141,444 L480F probably damaging Het
Vps13d G A 4: 145,062,602 P3817L probably damaging Het
Xpr1 A G 1: 155,290,161 probably benign Het
Zfhx3 A G 8: 108,793,779 E511G probably benign Het
Zfp560 C T 9: 20,348,723 C281Y probably damaging Het
Other mutations in Pah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Pah APN 10 87578893 missense probably benign 0.02
IGL00823:Pah APN 10 87570331 missense probably null 1.00
IGL01350:Pah APN 10 87578359 intron probably benign
IGL01668:Pah APN 10 87578261 missense probably damaging 1.00
IGL01794:Pah APN 10 87578922 missense possibly damaging 0.63
IGL01956:Pah APN 10 87538199 missense probably benign 0.03
IGL01985:Pah APN 10 87578982 missense probably damaging 1.00
IGL02014:Pah APN 10 87581927 missense probably benign 0.00
IGL02552:Pah APN 10 87578845 intron probably benign
IGL03096:Pah APN 10 87538242 critical splice donor site probably null
bronze UTSW 10 87570226 missense probably damaging 1.00
parakeet UTSW 10 87576215 critical splice donor site probably null
skeet UTSW 10 87538219 nonsense probably null
R0238:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0239:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0239:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0839:Pah UTSW 10 87522062 missense probably damaging 1.00
R0853:Pah UTSW 10 87576218 splice site probably null
R1474:Pah UTSW 10 87578313 missense probably damaging 1.00
R1762:Pah UTSW 10 87567468 missense possibly damaging 0.91
R1886:Pah UTSW 10 87528328 missense possibly damaging 0.91
R2179:Pah UTSW 10 87567335 missense probably damaging 1.00
R2852:Pah UTSW 10 87567465 missense probably damaging 1.00
R3818:Pah UTSW 10 87522004 start gained probably benign
R4725:Pah UTSW 10 87554376 missense probably damaging 1.00
R4911:Pah UTSW 10 87570267 missense probably benign 0.42
R5094:Pah UTSW 10 87538219 nonsense probably null
R5766:Pah UTSW 10 87567347 missense probably damaging 1.00
R6210:Pah UTSW 10 87583561 missense probably benign 0.01
R6273:Pah UTSW 10 87576215 critical splice donor site probably null
R6345:Pah UTSW 10 87576187 missense probably damaging 1.00
R6349:Pah UTSW 10 87578969 missense probably benign 0.01
R7109:Pah UTSW 10 87570286 missense probably damaging 1.00
Z1088:Pah UTSW 10 87571291 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATGTCTAACAATATTCAGGGTC -3'
(R):5'- TGAGAATATCCACATGCAAGCTG -3'

Sequencing Primer
(F):5'- GTCTATCTGGACCCTTCAGAAG -3'
(R):5'- GCAAGCTGATATAAAAGTCAGTCC -3'
Posted On2015-07-21