Incidental Mutation 'R4509:Tnip1'
ID331128
Institutional Source Beutler Lab
Gene Symbol Tnip1
Ensembl Gene ENSMUSG00000020400
Gene NameTNFAIP3 interacting protein 1
SynonymsABIN1, VAN, A20-binding inhibitor of NF-kappa B activation, Nef
MMRRC Submission 041758-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4509 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location54910785-54962917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54926790 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 244 (S244C)
Ref Sequence ENSEMBL: ENSMUSP00000122836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018482] [ENSMUST00000102730] [ENSMUST00000102731] [ENSMUST00000108885] [ENSMUST00000108886] [ENSMUST00000108889] [ENSMUST00000126703]
Predicted Effect probably benign
Transcript: ENSMUST00000018482
AA Change: S297C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018482
Gene: ENSMUSG00000020400
AA Change: S297C

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102730
AA Change: S297C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099791
Gene: ENSMUSG00000020400
AA Change: S297C

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 3e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 627 640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102731
AA Change: S297C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099792
Gene: ENSMUSG00000020400
AA Change: S297C

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108885
AA Change: S244C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104513
Gene: ENSMUSG00000020400
AA Change: S244C

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SCOP:d1bg1a1 289 458 5e-4 SMART
low complexity region 466 490 N/A INTRINSIC
low complexity region 507 524 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108886
AA Change: S244C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104514
Gene: ENSMUSG00000020400
AA Change: S244C

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SCOP:d1bg1a1 289 458 5e-4 SMART
low complexity region 466 490 N/A INTRINSIC
low complexity region 507 524 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108889
AA Change: S297C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104517
Gene: ENSMUSG00000020400
AA Change: S297C

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124304
Predicted Effect probably benign
Transcript: ENSMUST00000126703
AA Change: S244C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000122836
Gene: ENSMUSG00000020400
AA Change: S244C

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an A20-binding protein which plays a role in autoimmunity and tissue homeostasis through the regulation of nuclear factor kappa-B activation. Mutations in this gene have been associated with psoriatic arthritis, rheumatoid arthritis, and systemic lupus erythematosus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal lethality associated with anemia and focal apoptosis in the fetal liver. Mice homozygous for a gene trap allele exhibit partial prenatal lethality and SLE-like inflammatory disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,966,755 L657P probably damaging Het
Adam4 A T 12: 81,421,747 C33* probably null Het
Adam6b T C 12: 113,490,352 V263A probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
Ascc3 T C 10: 50,842,243 F2011L probably benign Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Cacna1d T C 14: 30,096,971 Y1209C probably damaging Het
Camta2 G A 11: 70,681,018 T484M probably benign Het
Ccdc178 T C 18: 22,067,392 N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cttnbp2nl T C 3: 105,032,747 N2S probably damaging Het
Gm15032 A T X: 142,622,626 noncoding transcript Het
Gzmg G A 14: 56,156,753 P228L probably damaging Het
Hao1 T A 2: 134,523,044 D221V probably damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Mdn1 C T 4: 32,715,883 R2022C probably damaging Het
Mipep T C 14: 60,827,321 Y375H probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Pah T C 10: 87,576,215 probably null Het
Perm1 T C 4: 156,217,586 S196P probably benign Het
Pik3c2g A T 6: 139,720,006 T18S probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Ppp3cb A T 14: 20,515,501 probably benign Het
Psd4 T C 2: 24,396,335 S316P probably benign Het
Ptpn18 T C 1: 34,462,742 V45A possibly damaging Het
Rasgrp3 A G 17: 75,500,673 M242V probably damaging Het
Repin1 T C 6: 48,596,526 C130R possibly damaging Het
Rrp1 G T 10: 78,412,822 T44K possibly damaging Het
Slc44a5 A G 3: 154,234,073 Y88C probably damaging Het
Socs1 C T 16: 10,784,354 R173Q probably benign Het
Speer3 T G 5: 13,796,354 N229K possibly damaging Het
Sult2a7 T A 7: 14,470,161 I226F probably damaging Het
Tdp1 G A 12: 99,955,065 probably benign Het
Tnfrsf21 G A 17: 43,085,388 S521N probably benign Het
Ubqln3 G A 7: 104,141,444 L480F probably damaging Het
Vps13d G A 4: 145,062,602 P3817L probably damaging Het
Xpr1 A G 1: 155,290,161 probably benign Het
Zfhx3 A G 8: 108,793,779 E511G probably benign Het
Zfp560 C T 9: 20,348,723 C281Y probably damaging Het
Other mutations in Tnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnip1 APN 11 54940817 nonsense probably null
IGL02045:Tnip1 APN 11 54911539 makesense probably null
IGL02227:Tnip1 APN 11 54936471 missense possibly damaging 0.90
IGL03093:Tnip1 APN 11 54940826 nonsense probably null
trinity UTSW 11 54939596 critical splice donor site probably null
R0480:Tnip1 UTSW 11 54937994 missense probably damaging 0.96
R0511:Tnip1 UTSW 11 54917873 missense probably damaging 1.00
R2974:Tnip1 UTSW 11 54933983 unclassified probably benign
R4059:Tnip1 UTSW 11 54911569 missense probably benign 0.01
R4475:Tnip1 UTSW 11 54939596 critical splice donor site probably null
R4510:Tnip1 UTSW 11 54926790 missense probably benign 0.00
R4511:Tnip1 UTSW 11 54926790 missense probably benign 0.00
R4702:Tnip1 UTSW 11 54924402 missense probably benign 0.03
R4784:Tnip1 UTSW 11 54915539 missense possibly damaging 0.66
R5008:Tnip1 UTSW 11 54937984 missense probably benign 0.01
R5461:Tnip1 UTSW 11 54910799 unclassified probably benign
R6050:Tnip1 UTSW 11 54917877 missense probably damaging 1.00
R6992:Tnip1 UTSW 11 54918716 missense probably benign 0.01
R7198:Tnip1 UTSW 11 54917804 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCATGGGCAGATGGTTCAATG -3'
(R):5'- GCAGCCACAGTATGCATCAG -3'

Sequencing Primer
(F):5'- CAGATGGTTCAATGGTTTCCAC -3'
(R):5'- GCATCAGCAAAGGGGAATGTTCC -3'
Posted On2015-07-21