Incidental Mutation 'R4511:Ddx17'
ID331184
Institutional Source Beutler Lab
Gene Symbol Ddx17
Ensembl Gene ENSMUSG00000055065
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 17
SynonymsA430025E01Rik, 2610007K22Rik, p72, LOC381024
MMRRC Submission 041586-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4511 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79527736-79546741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79538592 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 315 (V315E)
Ref Sequence ENSEMBL: ENSMUSP00000155307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054014] [ENSMUST00000229431] [ENSMUST00000229877] [ENSMUST00000231053]
Predicted Effect probably damaging
Transcript: ENSMUST00000054014
AA Change: V315E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055535
Gene: ENSMUSG00000055065
AA Change: V315E

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:DEXDc 29 87 7e-18 BLAST
DEXDc 111 314 4.79e-65 SMART
HELICc 353 434 3.34e-32 SMART
low complexity region 477 486 N/A INTRINSIC
low complexity region 550 576 N/A INTRINSIC
low complexity region 578 611 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229431
AA Change: V315E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000229877
AA Change: V315E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231053
AA Change: V315E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the mouse homolog of human DEAD box polypeptide 17. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD). RNA helicases of the DEAD-box family are involved in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and splicesosome assembly. Alternative splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,277,328 S1530P possibly damaging Het
9330159F19Rik T A 10: 29,224,823 D397E probably benign Het
Abcc10 A G 17: 46,307,210 F1005L probably damaging Het
Ackr4 T C 9: 104,098,731 E339G probably benign Het
Adam39 G T 8: 40,826,291 C573F probably damaging Het
Anks1b A G 10: 90,510,790 T651A probably benign Het
Aoc1 C A 6: 48,907,806 H594Q probably damaging Het
Atp4a G T 7: 30,724,253 E928* probably null Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Atp8b5 A G 4: 43,320,629 T206A probably damaging Het
Atrn G A 2: 130,935,577 W182* probably null Het
BC017158 A T 7: 128,276,140 F319Y probably damaging Het
Cacna1e G A 1: 154,561,833 T257I probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Crebrf A G 17: 26,742,964 Y345C probably benign Het
Cyp26b1 G A 6: 84,574,491 R248W probably damaging Het
Dclk3 C A 9: 111,467,992 H201Q probably benign Het
Dhrs11 T C 11: 84,825,516 *51W probably null Het
Fgfr4 C A 13: 55,161,515 P455Q possibly damaging Het
Gabbr1 A G 17: 37,069,211 K697E probably damaging Het
Gcnt1 G A 19: 17,330,277 T28I probably benign Het
Gm12185 T A 11: 48,908,478 H396L possibly damaging Het
Gm12794 A T 4: 101,941,560 M243L probably benign Het
Gm21976 A G 13: 98,305,331 R123G probably benign Het
Hecw1 A C 13: 14,357,191 V166G probably damaging Het
Hpx A G 7: 105,592,088 V372A possibly damaging Het
Igkv2-109 A G 6: 68,302,978 Y61C probably damaging Het
Igsf1 A G X: 49,786,173 F789S probably damaging Het
Il4ra A G 7: 125,576,108 D496G possibly damaging Het
Ilf3 A G 9: 21,399,215 T547A possibly damaging Het
Insrr C A 3: 87,808,671 P558T possibly damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Irak3 T A 10: 120,145,908 H393L probably damaging Het
Isx G A 8: 74,873,670 M10I probably benign Het
Itga11 A G 9: 62,761,588 D709G probably damaging Het
Kcng2 G T 18: 80,295,715 R453S probably benign Het
Kif5b A G 18: 6,214,011 V664A probably benign Het
Lalba A G 15: 98,482,541 L44P probably benign Het
Ldlrad1 T G 4: 107,209,518 F17V probably benign Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Lrp1 T C 10: 127,593,848 Y451C probably damaging Het
Lrp2 A T 2: 69,480,062 N2722K possibly damaging Het
Mctp1 G A 13: 76,825,272 V431I probably benign Het
Mmrn2 T C 14: 34,403,059 F866L possibly damaging Het
Mylk2 A G 2: 152,917,410 E367G probably damaging Het
Nfatc1 A G 18: 80,635,579 S865P probably damaging Het
Nol6 G C 4: 41,123,526 T74R probably damaging Het
Notch2 T C 3: 98,146,321 M2100T probably benign Het
Parp1 A G 1: 180,591,276 K667R possibly damaging Het
Phlda3 A G 1: 135,766,662 T72A probably damaging Het
Polg T C 7: 79,455,522 Q758R probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Prkd1 T C 12: 50,392,979 D355G possibly damaging Het
Prpf8 T C 11: 75,491,826 Y398H probably damaging Het
Ripk1 T C 13: 34,026,748 Y309H probably damaging Het
Rngtt A T 4: 33,339,032 Q279L possibly damaging Het
Samd4 T A 14: 47,077,585 V114D probably benign Het
Sec23ip G A 7: 128,779,176 E956K probably damaging Het
Slc4a1ap A T 5: 31,527,403 T128S probably benign Het
Slc5a11 A T 7: 123,235,635 I6F probably benign Het
Slc6a19 A C 13: 73,683,975 L494R probably damaging Het
Slc6a21 A G 7: 45,287,289 D189G probably damaging Het
Slc7a1 G T 5: 148,340,562 A381D probably damaging Het
Smc4 T A 3: 69,016,647 probably null Het
Stk19 T C 17: 34,832,528 E17G probably damaging Het
Tekt5 A C 16: 10,358,013 V556G probably benign Het
Tenm4 T C 7: 96,894,863 F2029L probably benign Het
Thnsl1 T C 2: 21,212,425 V330A probably damaging Het
Tnfrsf21 A G 17: 43,065,019 D432G probably damaging Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Tnrc6c A T 11: 117,742,958 N1294I possibly damaging Het
Trpm3 A G 19: 22,988,017 I1625M probably benign Het
Ttn A T 2: 76,745,429 V25040E probably damaging Het
Vwa5a A G 9: 38,722,557 N19D possibly damaging Het
Washc2 A T 6: 116,220,556 D250V probably damaging Het
Xpo1 A G 11: 23,287,401 T755A possibly damaging Het
Zfp462 C T 4: 55,008,934 T300I possibly damaging Het
Zfp937 A C 2: 150,238,511 T154P probably damaging Het
Zzef1 A G 11: 72,888,170 D1819G probably benign Het
Other mutations in Ddx17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Ddx17 APN 15 79530376 missense probably benign
IGL02904:Ddx17 APN 15 79530437 nonsense probably null
PIT4469001:Ddx17 UTSW 15 79543813 missense probably damaging 1.00
R0437:Ddx17 UTSW 15 79537471 missense probably damaging 1.00
R0507:Ddx17 UTSW 15 79537557 splice site probably benign
R1160:Ddx17 UTSW 15 79541087 missense probably damaging 1.00
R1456:Ddx17 UTSW 15 79530376 missense probably benign
R1572:Ddx17 UTSW 15 79538565 missense probably damaging 0.99
R4510:Ddx17 UTSW 15 79538592 missense probably damaging 1.00
R4576:Ddx17 UTSW 15 79541146 missense probably benign
R6955:Ddx17 UTSW 15 79530467 missense probably benign 0.01
R7152:Ddx17 UTSW 15 79530263 missense possibly damaging 0.53
R7320:Ddx17 UTSW 15 79531904 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATTTAGGACAGTTTCAACCTCC -3'
(R):5'- ACCGGATGCTTGATATGGGC -3'

Sequencing Primer
(F):5'- ATAAAAGATCCCCCTGGCTTTCTCAG -3'
(R):5'- GAGCCCCAGATCCGTAAAATTGTTG -3'
Posted On2015-07-21