Incidental Mutation 'R4510:Atrn'
ID331195
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Nameattractin
SynonymsMgca
MMRRC Submission 041585-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4510 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location130906495-131030333 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 130935577 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 182 (W182*)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
Predicted Effect probably null
Transcript: ENSMUST00000028781
AA Change: W182*
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: W182*

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156982
Meta Mutation Damage Score 0.588 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,277,328 S1530P possibly damaging Het
9330159F19Rik T A 10: 29,224,823 D397E probably benign Het
Abcc10 A G 17: 46,307,210 F1005L probably damaging Het
Ackr4 T C 9: 104,098,731 E339G probably benign Het
Adam39 G T 8: 40,826,291 C573F probably damaging Het
Anks1b A G 10: 90,510,790 T651A probably benign Het
Aoc1 C A 6: 48,907,806 H594Q probably damaging Het
Arid1a A C 4: 133,695,699 probably benign Het
Atp4a G T 7: 30,724,253 E928* probably null Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Atp8b5 A G 4: 43,320,629 T206A probably damaging Het
BC017158 A T 7: 128,276,140 F319Y probably damaging Het
Cacna1e G A 1: 154,561,833 T257I probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Crebrf A G 17: 26,742,964 Y345C probably benign Het
Cyp26b1 G A 6: 84,574,491 R248W probably damaging Het
Dclk3 C A 9: 111,467,992 H201Q probably benign Het
Ddx17 A T 15: 79,538,592 V315E probably damaging Het
Dhrs11 T C 11: 84,825,516 *51W probably null Het
Fgfr4 C A 13: 55,161,515 P455Q possibly damaging Het
Gabbr1 A G 17: 37,069,211 K697E probably damaging Het
Gcnt1 G A 19: 17,330,277 T28I probably benign Het
Gga2 G A 7: 122,021,078 T4M unknown Het
Gm12185 T A 11: 48,908,478 H396L possibly damaging Het
Gm12794 A T 4: 101,941,560 M243L probably benign Het
Gm21976 A G 13: 98,305,331 R123G probably benign Het
Hecw1 A C 13: 14,357,191 V166G probably damaging Het
Hpx A G 7: 105,592,088 V372A possibly damaging Het
Igkv2-109 A G 6: 68,302,978 Y61C probably damaging Het
Igsf1 A G X: 49,786,173 F789S probably damaging Het
Il4ra A G 7: 125,576,108 D496G possibly damaging Het
Ilf3 A G 9: 21,399,215 T547A possibly damaging Het
Insrr C A 3: 87,808,671 P558T possibly damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Irak3 T A 10: 120,145,908 H393L probably damaging Het
Isx G A 8: 74,873,670 M10I probably benign Het
Itga11 A G 9: 62,761,588 D709G probably damaging Het
Kcng2 G T 18: 80,295,715 R453S probably benign Het
Kif5b A G 18: 6,214,011 V664A probably benign Het
Lalba A G 15: 98,482,541 L44P probably benign Het
Ldlrad1 T G 4: 107,209,518 F17V probably benign Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Lrp1 T C 10: 127,593,848 Y451C probably damaging Het
Lrp2 A T 2: 69,480,062 N2722K possibly damaging Het
Mctp1 G A 13: 76,825,272 V431I probably benign Het
Mmrn2 T C 14: 34,403,059 F866L possibly damaging Het
Mylk2 A G 2: 152,917,410 E367G probably damaging Het
Nfatc1 A G 18: 80,635,579 S865P probably damaging Het
Nol6 G C 4: 41,123,526 T74R probably damaging Het
Notch2 T C 3: 98,146,321 M2100T probably benign Het
Parp1 A G 1: 180,591,276 K667R possibly damaging Het
Phlda3 A G 1: 135,766,662 T72A probably damaging Het
Polg T C 7: 79,455,522 Q758R probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Prkd1 T C 12: 50,392,979 D355G possibly damaging Het
Prpf8 T C 11: 75,491,826 Y398H probably damaging Het
Ripk1 T C 13: 34,026,748 Y309H probably damaging Het
Rngtt A T 4: 33,339,032 Q279L possibly damaging Het
Samd4 T A 14: 47,077,585 V114D probably benign Het
Sec23ip G A 7: 128,779,176 E956K probably damaging Het
Slc4a1ap A T 5: 31,527,403 T128S probably benign Het
Slc5a11 A T 7: 123,235,635 I6F probably benign Het
Slc6a19 A C 13: 73,683,975 L494R probably damaging Het
Slc6a21 A G 7: 45,287,289 D189G probably damaging Het
Slc7a1 G T 5: 148,340,562 A381D probably damaging Het
Smc4 T A 3: 69,016,647 probably null Het
Stk19 T C 17: 34,832,528 E17G probably damaging Het
Tekt5 A C 16: 10,358,013 V556G probably benign Het
Tenm4 T C 7: 96,894,863 F2029L probably benign Het
Thnsl1 T C 2: 21,212,425 V330A probably damaging Het
Tnfrsf21 A G 17: 43,065,019 D432G probably damaging Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Tnrc6c A T 11: 117,742,958 N1294I possibly damaging Het
Trpm3 A G 19: 22,988,017 I1625M probably benign Het
Ttn A T 2: 76,745,429 V25040E probably damaging Het
Vwa5a A G 9: 38,722,557 N19D possibly damaging Het
Washc2 A T 6: 116,220,556 D250V probably damaging Het
Xpo1 A G 11: 23,287,401 T755A possibly damaging Het
Zfp462 C T 4: 55,008,934 T300I possibly damaging Het
Zfp937 A C 2: 150,238,511 T154P probably damaging Het
Zzef1 A G 11: 72,888,170 D1819G probably benign Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130958079 missense probably damaging 1.00
IGL00571:Atrn APN 2 130995048 missense probably damaging 1.00
IGL01092:Atrn APN 2 130947636 nonsense probably null
IGL01572:Atrn APN 2 131002795 missense probably damaging 1.00
IGL01924:Atrn APN 2 130935565 missense probably damaging 1.00
IGL02116:Atrn APN 2 130958089 missense probably damaging 1.00
IGL02372:Atrn APN 2 131002754 splice site probably benign
IGL02390:Atrn APN 2 131020977 missense possibly damaging 0.82
IGL02548:Atrn APN 2 130972282 missense probably damaging 1.00
IGL02749:Atrn APN 2 130970144 nonsense probably null
IGL02749:Atrn APN 2 130947734 splice site probably benign
R0026:Atrn UTSW 2 130957920 missense probably damaging 1.00
R0403:Atrn UTSW 2 130906859 missense probably damaging 1.00
R0479:Atrn UTSW 2 130999165 nonsense probably null
R0544:Atrn UTSW 2 130986826 missense probably damaging 1.00
R0570:Atrn UTSW 2 130980134 missense probably benign 0.01
R0606:Atrn UTSW 2 130906856 missense possibly damaging 0.90
R0617:Atrn UTSW 2 130995085 critical splice donor site probably null
R0658:Atrn UTSW 2 130970227 critical splice donor site probably null
R1108:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1112:Atrn UTSW 2 130999161 missense probably benign 0.04
R1219:Atrn UTSW 2 131021007 missense possibly damaging 0.90
R1422:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1524:Atrn UTSW 2 130957080 missense probably benign 0.15
R1653:Atrn UTSW 2 130935624 missense probably benign
R1795:Atrn UTSW 2 130972288 missense probably benign
R1807:Atrn UTSW 2 130982772 missense possibly damaging 0.94
R1920:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1921:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1935:Atrn UTSW 2 130958035 missense probably damaging 1.00
R1982:Atrn UTSW 2 130970222 missense probably benign
R2000:Atrn UTSW 2 130935588 missense probably damaging 1.00
R2143:Atrn UTSW 2 130957996 missense probably benign 0.03
R2336:Atrn UTSW 2 130957954 missense probably damaging 1.00
R2679:Atrn UTSW 2 130961675 critical splice donor site probably null
R3426:Atrn UTSW 2 131020956 missense probably benign 0.06
R3909:Atrn UTSW 2 130994207 missense probably damaging 1.00
R4077:Atrn UTSW 2 130964930 critical splice donor site probably null
R4162:Atrn UTSW 2 130994228 splice site probably benign
R4195:Atrn UTSW 2 130933412 missense probably damaging 1.00
R4364:Atrn UTSW 2 130970208 missense probably benign 0.39
R4465:Atrn UTSW 2 130960468 missense probably benign 0.08
R4511:Atrn UTSW 2 130935577 nonsense probably null
R4527:Atrn UTSW 2 130973504 missense probably benign 0.10
R4586:Atrn UTSW 2 130982042 missense probably damaging 1.00
R4592:Atrn UTSW 2 130999130 intron probably benign
R4658:Atrn UTSW 2 130933429 missense probably damaging 1.00
R4735:Atrn UTSW 2 131020990 missense probably benign 0.06
R4960:Atrn UTSW 2 130995047 nonsense probably null
R4999:Atrn UTSW 2 130975954 missense probably damaging 1.00
R5066:Atrn UTSW 2 130994193 missense possibly damaging 0.60
R5080:Atrn UTSW 2 130970124 missense possibly damaging 0.95
R5141:Atrn UTSW 2 130999130 intron probably benign
R5256:Atrn UTSW 2 130946019 missense probably benign 0.39
R5494:Atrn UTSW 2 131023075 missense probably damaging 1.00
R5678:Atrn UTSW 2 130970016 missense probably damaging 0.96
R5752:Atrn UTSW 2 130906544 unclassified probably benign
R5931:Atrn UTSW 2 130933436 missense possibly damaging 0.56
R6023:Atrn UTSW 2 131020980 missense probably benign 0.25
R6176:Atrn UTSW 2 130946091 missense probably benign 0.31
R6377:Atrn UTSW 2 130979969 missense probably damaging 1.00
R6433:Atrn UTSW 2 131023027 missense probably damaging 1.00
R7226:Atrn UTSW 2 130986744 missense probably damaging 0.99
X0024:Atrn UTSW 2 130958139 missense probably damaging 1.00
Z1088:Atrn UTSW 2 130973399 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGCCCGTGTCTCTTTTGG -3'
(R):5'- GAACTGTAGCTCACCAGAACAG -3'

Sequencing Primer
(F):5'- ACTAGATCTCTGACAAATGCAGG -3'
(R):5'- CAGAACTAATTCCATGAGATGAGTG -3'
Posted On2015-07-21